For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034613
Protocol 37572: Probe Assay - Kmt2a<em3(indel)Lutzy>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 88 bp
Wild Type = 148 bp
>chr9:44853132-44853279 148bp TCTTTGAAAGGTTTGGACCTG CAAACAGTCTATAAAGTCACAGAGTTG
Sequence
Wt Sequence (with deletion in lowercase):
TTATGTTATTATTCCCTATATGTCTGTAGCTATAAGGACTTGCTATATTTGTGGCTGTGTATTTTTATACTGATTTGCTTATTTGTATTAAAATTATCTTTGAAAGGTTTGGACCTGGACCtgtagtttgaaattcaggactattccttatctaatgctcaccagagagaagctttctatgcattgctgagtgatcacacagctactatgtgtgatgcaactctgtgactttatagactgtttggataatgatgattgggatgcacacaccaattttccaatgcatttgtttcatctaggcctttcctttggatttattcacatttatgtttttgtttctgattttaaaataattttcctttgttgtaggatgagcagttcttaggttttggctcagatgaagaagtcagagtgcgaagccccaccaggtctccttcaggtatggccaataaagcacgtgtcacagatctgcattctgtctgttaggagagtatggcttcctcctgccttgttgttagtaaggatgattgcagccCAGGCCAGGAAACTGTGTGAGCTAGACTGGGCAGACTGGTTCCTGCTGCCTGTGCTTGTAAATTCTTCACTCTGTTTTCCTGGGTAATACTTGGGCATGGGAAGTAGGTTTCTACAGAAAGATTTTGGGAA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 51688 | TCT TTG AAA GGT TTG GAC CTG | Common | A | |||
| 51689 | CAA ACA GTC TAT AAA GTC ACA GAG TTG | Wild type Reverse | A | |||
| 51690 | Fluorophore-1 | AGC TTT CTA TGC ATT GCT GAG TG | Quencher-1 | WT Probe | ||
| 51691 | ATT TAC AAG CAC AGG CAG CA | Mutant Reverse | A | |||
| 51692 | Fluorophore-2 | CCA GGA AAC TGT GTG AGC TAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 51688 | 0.40 uM |
| 51689 | 0.40 uM |
| 51691 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.