Protocol 37127: Probe Assay - Slc25a44<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr3:88420606-88420698 93bp GTGAGAAAATGGGTCGCTTC GGATCTGCCTGATGATGTCC

Mut = 93 bp

Wt = 93 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

TGTGATGCCAAGACCTAGGAAAGAGACAAAATTCAGAATGGTTGGTCCTACACACCGAGTAGGGGCTGATGTGTGGTGTGGTCAGCGTTGCTGTGTGGTGAGGAATGATttcagaagggcttgtcaaagacagaagtgcagagacaatgcactgggtcgtggacgcactgagccaggctgtttgaaggctaggcttcgctgaggtgagtgtcctgaagatacagcccgagaggtggacttggcagcctaggcaggaggggaaagcaatgctgtcctgaccttcctcacatctctcgcctgcccaaaccccaggtctccgggcacaatggaggacaaacggaacatccagatcatcgagtgggagcacctggacaagaagaagttctatgtgtttggtgttgctatgacaatgatgatcagggtcagcgtgtacccgttcaccctcatccgcacccgcctgcaggtccagaagggcaagagcctctaccacgggaccttcgatgcctttgtcaagatcctgcgagcagatggagtggcgggcctctaccgggggttcctggtcaacaccttcacactcatctccggccagtgctatgtcaccacttacgagctcacccggaagtttgtggcagactacagccagagtaacacagtcaaatcactcgtagccgggggctcggcctcccttgtggcccagagcatcacggtgccgatcgatgttgtctcccaacatctgatgatgcagcggaagggtgagaaaatgggtcgcttccaagtgcacgggaacctagagggacaaggggtgattgcctttggccagactaaggacatcatcaggcagatccttcgggctgacggtctccgaggcttctaccggggctatgtggcctcgctgctaacgtacatcccaaacagtgctgtctggtggcccttctaccacttctatgcaggtaagcaggggcttggaaggagagcacttactggtggggcgggggacacttgctcctggctgattttagagtggagatgagtacagagaggggaccagatcagccccactgagtgttgggatcactggtgtacgcccccagtcaagcccagccgagcccagcccaacccgagtttgctagcacctgtttcttctgcttagcgcagtatcgcacctcgacTTTGTGGTAAAGCTAAACTCTGTACTGACCCTTTGGGAGTACACTCTGGCAATCTGTTTTTTTTTTTTTTTGTTCTTGTGGTTTTGTGAGGCAGGGTCTCTCTGTT

This mutation is a 1060 bp deletion beginning at Chromosome 3 position 88,420,282 bp and ending after 88,421,341 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50595 GTG AGA AAA TGG GTC GCT TC Wild type Forward A
50596 GGA TCT GCC TGA TGA TGT CC Wild type Reverse A
50597 ACC GAG TAG GGG CTG ATG T Mutant Forward A
50598 CCC AAA GGG TCA GTA CAG AGT Mutant Reverse A
50599 Fluorophore-1 AAC CTA GAG GGA CAA GGG GTG A Quencher-1 WT Probe
50600 Fluorophore-2 TGG TGA GGA ATG ATT TTG TGG TAA A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
50595 0.40 uM
50596 0.40 uM
50597 0.40 uM
50598 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.