For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034512
Protocol 37676: Probe Assay - Cpa5<em1(IMPC)J> Alternate 1
Version 2.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:30614129+30614224 96bp TCTTCCAACCCTGAAACTTCC CATGTCCCTAACATGGCAGA
Mut = 116 bp
Wt = 96 bp
Fam = Mut
Hex = Wt
Sequence
Wt Sequence (deletions in lower case):
CAGGTTCAGACCCCAGAGCTTGAGATGTGGGACTCTACATTGTCATCTTCCACCTACCCCATGGAAGGAAGCAAGCATGGCTCCTCTGCCCCAAGgttggggttattttatatcacctttcatggggggtgggtagcacaggaactgtcattggttccccagttccctttagtccatctgcccactccctcatcccttctgttatgtgccagggctccttcacttcagtgtcccctctcttccacactggctctgtcaatcgccctagcctccacagctttcctcacccttcccatcttttcccagagaccaggttcttcgagtcctggccaaaaatgagaagcagctgtcacttctcagggatctggagacccagaagccccagaaggtgaggattgttcctggggatactactgtcaccacatttgcacctcagttccttgtcttgaccccttacatcttccaaccctgaaacttccttcctgaggtctccaaaaaggatcactagattctggacaagtccaagGTGGCTTCTCTGCCATGTTAGGGACATGTCCCCATAAATTTGGGTGGCCTTTGTAAGCTGTGATTCCTTTAGCTTTCCCT
This mutation is a 431 bp deletion beginning at Chromosome 6 position 30,613,766 bp and ending after 30,614,196 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 50465 | CAT GTC CCT AAC ATG GCA GA | Common | A | |||
| 50466 | TCT TCC AAC CCT GAA ACT TCC | Wild type Forward | A | |||
| 50467 | AGA CCC CAG AGC TTG AGA TG | Mutant Forward | A | |||
| 50468 | Fluorophore-1 | AGG ATC ACT AGA TTC TGG ACA AGT CC | Quencher-1 | WT Probe | ||
| 51939 | Fluorophore-2 | ATC TTC CAC CTA CCC CAT GGA AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 50465 | 0.40 uM |
| 50466 | 0.40 uM |
| 50467 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.