Protocol 36947: Probe Assay - Serpina3i<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr12:104266648+104266750 103bp AAGATGCAGCAGGTGGAAAC CCTAACCAGGTCTGGGTCCT

Mut = 107 bp

Wt = 103 bp

Fam = Mut

Hex = Wt

Sequence

Wt Sequence (deletions in lower case):

 ATTCAGAGTTCTGTGTCTTCCAAGGGGTTTCTAATCATTATAAAACTACTAAGGGACACTGTGCTGTTGAAGGTATATTGACAGctgtcaggactcagcagtgggtgccatatagcatggaggtgcgctctctgtgctagtgttacaatctgatgatttgctccacatttaggcaaatggaagatgccctttgacccccgtgatacatttaattccaagttttacttggatgagaagaggtctgtgaaggtgccaatgatgaaaatagaggaactaactacaccctacttccgggatgatgagctgtcctgctctgtggtagagctgaagtacacaggaaatgccagtgccctgttcattctccctgaccagggcaagatgcagcaggtggaaaccagcttgcatccagagaccctgaggaagtggaagaactctctgaaacccaggtgcatacccacaggacccagacctggttaggattcccttagtgctgttgtcctgatatctagtatcccagtacctcagagtctcacttacagcctgtgtaattgttaaagtgtcagcaggggacaggtgaagttgaattgagttccctccactgtctcaggtgtttcaggcctgattttactgtggtttttgttcttcacaatatgtgacaatctcacacagtgagatgaggtttttccccCTCTCTAATAGCCTGTAAATTATATGGAAATGATTGAGAGTTGTAAGCCACAGGGATTGTGATTAACAGGAGAT

This mutation is a 604 bp deletion beginning at Chromosome 12 position 104,266,357 bp and ending after 104,266,960 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
50127 AAG ATG CAG CAG GTG GAA AC Wild type Forward A
50128 CCT AAC CAG GTC TGG GTC CT Wild type Reverse A
50129 AAA ACT ACT AAG GGA CAC TGT GCT G Mutant Forward A
50130 AAT CAC AAT CCC TGT GGC TTA C Mutant Reverse A
50131 Fluorophore-1 CCA GAG ACC CTG AGG AAG TGG Quencher-1 WT Probe
50132 Fluorophore-2 TGA AGG TAT ATT GAC AGC TCT CTA ATA GCC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
50127 0.40 uM
50128 0.40 uM
50129 0.40 uM
50130 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.