Protocol 36760: Probe Assay - Zfand3<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:30060842+30060967 126bp GCTTTGCTGGTAAGTGCAGA TGCAAAATCCAAAGGAGAGC

Mutant=  98 bp

Wild Type = 126 bp

Sequence

Wt Sequence (deletions in lower case):

TACTGTTCCCAGTTGTAAACCGCAGCAAATAAAACAAGACATTGGCTCATGCAAAGGTAAAAGAAAACCCATGCAGCTTACTTTAGTTTTGTTTGCTTTTGTTTTGTTGGGGGTGGGATAGACAGACAGCTGGCCAGACTTGTTCTTAGCTTATTAGTTCAgttgtctggccagcaaattctttgcttgtatttaattttttgttttgattagaatgatacagaattttttagctcttctttctttcttttctttcttttcttttttctttcttttttcttttcttttcttttcttttttttttttttgccccaggtccagcaagactatgaatctctgttccaaatgctttgctggtaagtgcagaaaagggtgtgggtgttttctgtgtccccccccccccaacgatttatttattttttctttttggttattttaagattaaattatttagctctcctttggattttgcatGGGGCTTTGTTATGTTTGTGCGTGAAAGCAGATTCTCTTCACTGGGCGCTTCATATATTTGCTTAAGATTGCTAAACTCATCTCTGAGGGAAATGAAGTTTCATGTGTACTTGCATCAAATCCAATTTGCTAAGCTCTTGGGGTACAGAGGAATTATAAAAAACATGTCTGGTTTAGTAGGGTCCTGTTTATT

 

A 313 bp deletion beginning at Chromosome 17 position 30,060,656 bp and ending after 30,060,968 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49692 GCT TTG CTG GTA AGT GCA GA Wild type Forward A
49693 TGC AAA ATC CAA AGG AGA GC Wild type Reverse A
49694 GGG TGG GAT AGA CAG ACA GC Mutant Forward A
49695 GCC CAG TGA AGA GAA TCT GC Mutant Reverse A
49696 Fluorophore-1 CTT ATT AGT TCA GGG GCT TTG TTA TGT Quencher-1 MUT Probe
49697 Fluorophore-2 TGT GGG TGT TTT CTG TGT CC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49692 0.40 uM
49693 0.40 uM
49694 0.40 uM
49695 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.