For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:110312428+110312539 112bp AGAGAGAGGGTGAGGAGGTG CAAATCCTCTTCCTACAACCAGA
Mutant= 93 bp
Wild Type = 112 bp
Sequence
Wt Sequence (deletions in lower case):
GGTTGCGTTTCCAGTATCATAGCCAGGGCTACATAGAGAAATCCCATCTCAAAAAACCAAAATAACAAAACAAAGCAAAACAAAAAATAGAGTTCAAAGTTGTCCTGGGTTATACAGGGAGTTGAAGACCAGCATGTGCTACCCGAGACACTGTGTCATAGAGAGAGGGTGAGGAGGTGCGCCAGAGTGCAAGGCctcggctaggccttcctcatagctcctgtctccagaggattgaaatagttatgtctggttgtaggaagaggatttgtttaaaaagtcatttattttgttttttagctaattgtaaagtctgctttgtggcacttgtccagtccttcagccattacaatattgtgggacagaaactggtaagtgtttcagccctctgtggtgacatcccctcaaaggagcatgtgtcacttgtggctaggactgggactttcttcttcttcttcttcttctccttctccttcttccttcttccttcttccttcttcttccttcttcttccttcttcttccttcttcttccttcttcttccttcttcttccttcttcttccttcttcttccttcttcttccttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttcttccttcttccttcttccttcttccttcttccttcttccttcttcttctttttttatttattattttttttattttttgagacagggtttctctgtgcagtcctgtcctggaactcactctgtagacccaagtaaacaaacaaacaaataaaacaaccaaacacaagctgggggtatgacttagtggtaggactgggtttaatccccagttctagaaaacaaaaggggaagaggacattttggcttggtatgatggttccaaggcctcaaactcagaaattcaccggcctctgcctcccaagtgctgggattacaggcatgtgccaccactgcctggctgaagctgggcttttctgcttaggttgtggagaacctaacaggaaggactgaggatattttgggactctgaaccccttatccaaaggatgggcgtgttttattgaaagcatatagaaccagacctagtatatgtagttgtcagtgactcaaacccttctcctgattgcggccagttaagattttcttgcctagctgagtatgttttcacatgactttaatcccagcactaggaggtagaggcaggacacaagatcggggctgggactgcagaggtggctccgtggttagcactgctgcagaggacctgagttaggtgcccagcacccccgtcaggcagcttacagcctcctgaggcagctgcacttgcatgcagagacatttacacataattaaaaagtaaacataacctcagcattcaggaagcagagacaggccggcctggtcacagatctagttccgggacagctagggatacacagacactctgtcttggggggaaaaaaaaggtcacagtcatgttctactgcattttgggtcaaagcttgcttgggaggatacccaagtccttgttgcaaatatcagatagcagagtggaaatagacaggaacacttaagcggggtttggagtatgtcttgtaccctcttattagctagtatgtagtttctctgaaaggctctccattccccagagggcacagcaattcactctgctctttgtcttgtctagggtgtcagcttgacagcggctcgggacagagggcagcttgtgttcctggagggtctcaagtcctctgtggaggtcctcttccactctcaggacgagcctcaccccctgcagtttctcaggtcagaaccatagtgctggggtggggcaggcaagggctgctgtgttgtgtgggaaggcagaagtgacttcagggatcagactctttccccgtgttcctgtgtgtcagatagcccctggctgccatcatgaagctgacggtgggtggtggtccccagagctgtgggaagcgtccgtcatttgcTGGGAGGATGGCGCGGTGATGTTACCCTGCTGTTTCGCTGATGGGGGCTTAGACCTCTCATGCACCTACTTTTGCTCTTTCTTGCCTTCATGTAGAAACTTCATCTTATGGGCCAGTGACCTTATTGGGACATAGCCATATTTGTTTGTCATTGATTGTCCCTGGAATATTGGGGGGGAAAATG
A 1813 bp deletion beginning at Chromosome 9 position 110,312,464 bp and ending after 110,314,276 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49602 | AGA GAG AGG GTG AGG AGG TG | Common | A | |||
| 49603 | CAA ATC CTC TTC CTA CAA CCA GA | Wild type Reverse | A | |||
| 49604 | GAG GTC TAA GCC CCC ATC AG | Mutant Reverse | A | |||
| 49605 | Fluorophore-1 | CGG CTA GGC CTT CCT CAT AG | Quencher-1 | WT Probe | ||
| 49606 | Fluorophore-2 | TGC AAG GCT GGG AGG AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49602 | 0.40 uM |
| 49603 | 0.40 uM |
| 49604 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.