Protocol 37498: Probe Assay - Mgst1<em1(IMPC)J>Alternate 3
Version 4.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:138151016+138151144 129bp TCCACATGGGGTTACAGTGA AATGCCTGTGCTCTGTCTCC

Mut = 131 bp

Wt = 129 bp

Fam = Mut

Hex = Wt

 

Sequence

Wt Sequence (deletions in lower case):

 TAAATAGGTAAATACCCCTACTGCTTTGTCATATCTCACAATATTTGGAAGTAGGGCGCTCATTTTGGTTTGTTTATGTTGTTACGTCGATGCTAGttgagcctggggccttgagtgctgtcatcacgctatccccagcacaagtgaattttttggttgttcttctttttcgtatttggaataggtttttgccaacccagaagactgcgctggctttggcaagggagagaatgccaagaagtttgttcgcactgacgagaaggtggaacgcgtgcgcaggtaaaccagtgtctctggaaattcctcactcaagaatcatgctcatggagtccagccaggatctcaggatcttagagactgggggaggggggatgatccacttaatctctgtagtaggtgtaacaactccagcaaattagatacatagagttctccacatggggttacagtgactcttgtcagcaattttgttgcagttctagactttattggggtcagtggctgtactctgtttatagatacataaagataatagtatgcaggagacagagcacaggcattagATTCTTGCAGCTATGTTATTTTTCTCTCAAATTCAGATGGTCAGTTCACATAAAACATCAAAGATC

This mutation is a 467 bp deletion beginning at Chromosome 6 position 138,150,680 bp and ending after 138,151,146 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49668 CCC CTA CTG CTT TGT CAT ATC T Mutant Forward A
51476 TCC ACA TGG GGT TAC AGT GA Wild type Forward A
51477 AAT GCC TGT GCT CTG TCT CC Wild type Reverse A
51478 GTG AAC TGA CCA TCT GAA TTT G Mutant Reverse A
51479 Fluorophore-1 ATT GGG GTC AGT GGC TGT ACT CT Quencher-1 WT Probe
51480 Fluorophore-2 ATT TGG AAG TAG GGC GCT CAT TT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49668 0.40 uM
51476 0.40 uM
51477 0.40 uM
51478 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.