For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 034296
Protocol 36820: Probe Assay - Pcdh11x<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 71 bp
Wild Type = 74 bp
>chrX:120400478+120400551 74bp AGTTTTGGCACAGGACAATG TCTGGTCAAGAACAGTCACAAATAC
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion): AGTCAAAATATTTTCGGACTTGATGTCATTGAAACACCAGAAGGAGACAAGATGCCCCAACTGATTGTTCaaaaggagttagatagagaagagaaggatacctatgtgatgaaagtaaaagttgaagatggtggctttcctcaaagatccagtacagctattttgcaagtaagtgttgctgatacaaacgacaatcacccaatcttcatagaaaaggaaa... ...aggaactgcctcttgataataccttcgttggctgtgattccatctccaagtgctcctccagcagttctgatccctacagtgtttctgagtgtagctatccagtgacaactttcaaggcccctgtgTCTGTGCATATCAGACCGGTAGGTAATCCTAGTTTCTAAGTCATCCTTTTAACTTATTACTCTCATTCTTTTCATCTGATATAGAATTGCAATGAACATTGATTTCTAAGATGGAACAAAACAATCATATT
Mutation details
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 49810 | TGT CAT TGA AAC ACC AGA AGG | Mutant Forward | A | |||
| 49811 | ACC TAC CGG TCT GAT ATG CAC | Mutant Reverse | A | |||
| 49812 | AGT TTT GGC ACA GGA CAA TG | Wild type Forward | A | |||
| 49813 | TCT GGT CAA GAA CAG TCA CAA ATA C | Wild type Reverse | A | |||
| 49814 | Fluorophore-1 | GAT GCC CCA ACT GAT TGT TCT C | Quencher-1 | MUT Probe | ||
| 49815 | Fluorophore-2 | CCA CCC TTA ATG TCC AAT GCC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 49810 | 0.40 uM |
| 49811 | 0.40 uM |
| 49812 | 0.40 uM |
| 49813 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.