Protocol 37482: Probe Assay - Grxcr1<em1(IMPC)J>Alternate 2
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr5:68031913+68032035 123bp GAAGGGAGACAAAGCCAGAA AATCCAGAGAGCCTGGTGCT

Mut = 150 bp

Wt = 123 bp

Fam = Mut

Hex = Wt

Sequence

Wt Sequence (deletions in lower case):

TCACAGGAGGGCTACCATCTCTGGAATTCAGCTCTGCCGTTGCTGTGGCAAGGGGGATGAACTGACAGCAGATCCATAATGGTGTAAACTGGTTCATGTGGGTGGAGGTGACCATGctaagaagggagacaaagccagaaagtgacaggccacggaaagtccggtttcgaattgcctcatctcacagtgggagagttctgaaagaggtctatgaagatggacaagcaccaggctctctggattctgaatgtgctagtatttgtgccatagatgggctaagtgactctgagggacagcaaaacggccacattggatcagaggataatgaacaggagaaagatcaggataacctgctggtattagccaggacagccagcgagaaggcttttggcacaagaagagtcaacattttaagcaaaaatggtacagtcagaggcgtcaagtacaaagtgagtgctggccaggctctgtttaacaatttgaccaaagtgttgCAGGTAAGTCATTATACACTTTCCTGTTCTGCGCTCTTCTCCTCACCCACCATCTCCACCCCTTTCAGTTCTCCAGGATGGAGTCAACGTCTCCTTCCTCCA

This mutation is a 378 bp deletion beginning at Chromosome 5 position 68,031,909 bp and ending after 68,032,286 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49112 CAC AGG AGG GCT ACC ATC TC Mutant Forward A
51437 GAA GGG AGA CAA AGC CAG AA Wild type Forward A
51438 AAT CCA GAG AGC CTG GTG CT Wild type Reverse A
51439 AGC GCA GAA CAG GAA AGT GT Mutant Reverse A
51440 Fluorophore-1 TCC GGT TTC GAA TTG CCT C Quencher-1 WT Probe
51441 Fluorophore-2 CAG CTC TGC CGT TGC TGT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49112 0.40 uM
51437 0.40 uM
51438 0.40 uM
51439 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.