Protocol 36499: Probe Assay - Otog<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr7:46245331+46245434 104bp ATGTCTTCGTGGGAAAGACG GGCTCTCTGTAGGCCACACT

Mut = 113 bp

Wt = 104 bp

Fam = Mut

Hex = Wt

Sequence

Wt Sequence (deletions in lower case):

 TGGGAGGAGGGTGGCAAGTGTCCCCTCTGCTCCTTCCCATTCCCCATGGGGACACCGGATTCCTGGGGCTAGGTAAGAATTTCTGGGGAGATCCCAGGATCCAGGGGCCAAAGTGGGGCAAGAACACAGAAAACTGGAAAATGATGGGTCAAGGCTTTCTCATGACGCAAGAAGGAGATGGTTTGAGGTCTGGCGAGCACgaagtcaggcttcacgtaccaaggaggggtggcaagcttggctggacctgccttttcttgagagacctctgctgggagccaggcttcatcttcggcatgtttaggtgtagaggaaagaggacgtggagccagatagcccagtgcacagaactaattgttctctgttcctaaaaggaggctgaagccttagccgcatcggccatgtcttcgtgggaaagacggctccatcgcgccaagtgtgcaccgtcgtgtaagttgcgccctctctgtggctatgcgtaggagagtgtggcctacagagagcctgccagggtaccacttgtgagccccttccggtgcctggagtctcttcctaccttccccagcttgatttgcatagcctcaccgtatcctggtcacatccttgtgtcccggctcctgctcacattgtctgattcgtgagtttgctgcctcacaagatggctgactcctcctccgacctcatactctttctggtcttgcttcctacttccagtgggatGATCCTTCAGTGTGCTAATTCCTGTGGTTAATTCTCTCTTTACCTCCCTTAGATCTAAGGCCTTCTCATCCCCCTTTTTCTGTCTGTGACCTAGTCCCATGTCCTGTGTCTGTGCGGGCCCCCATCAGAGTCCCATGTCTGTCCTGTCCGTGAC

This mutation is a 520 bp deletion beginning at Chromosome 7 position 46,245,130 bp and ending after 46,245,649 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48921 ATG TCT TCG TGG GAA AGA CG Wild type Forward A
48922 GGC TCT CTG TAG GCC ACA CT Wild type Reverse A
48923 GGA GAT GGT TTG AGG TCT GG Mutant Forward A
48924 CAG ACA GAA AAA GGG GGA TG Mutant Reverse A
48925 Fluorophore-1 TCG TGT AAG TTG CGC CCT Quencher-1 WT Probe
48926 Fluorophore-2 CAC GAT CCT TCA GTG TGC TAA TT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48921 0.40 uM
48922 0.40 uM
48923 0.40 uM
48924 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.