For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 70 bp
Wild Type = 82 bp
>chr4:138835157+138835238 82bp AGGCCCTCACAAGTAAAGCAAT CGCATACTTTATATTCGTCTCATTC
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
Mutation details
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
49458 | CAG CCG GGA GAT AAT AAC CA | Mutant Forward | A | |||
49459 | CGC ATA CTT TAT ATT CGT CTC ATT C | Common | A | |||
49460 | AGG CCC TCA CAA GTA AAG CAA T | Wild type Forward | A | |||
49461 | Fluorophore-1 | CAG ACA ACT GCG TGT GTG TTC TCA | Quencher-1 | WT Probe | ||
49462 | Fluorophore-2 | CAG CTC CGT GTC CGT TTT CC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
49458 | 0.40 uM |
49459 | 0.40 uM |
49460 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |