For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 033802
Protocol 36044: Probe Assay - Peak1<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:56241294-56241420 127bp CACACCCTGCTCTATAAATC GTTCTTGGATCCCGAGGAGA
Mut= 126 bp
Wt= 127 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTCTTCCTTTAAAAAAGAAAAACAAGCAAACATGTAGGTTTAATGACCAGGTATGAAGGTCTCAGATCCTTTCTAGTTAGCTCTGACTATCCTGGAACTTACTATATAAACCAAGCTGGCCTGGAACTCACCAAGCTATACACCTGCATCTGCCTCCCAAGTGCTGGGATTAAAGACCTGTGCCACCACACCCTGCTCTATAAATCTAAATGTTAATAGAACTTTTGAATACAAATTTgatggactgtcttatttgtttcagtcgtgtgacccatgaagtggcaggagaactttctcctcgggatccaagaactcctgctgggaagcaagatggcacttcagtcacaccaacactgcctccacctgacctggaaagggaagaagaaaaagatgacactttggatcctactgacgtgagtccctgcagtgcaacctacagcaacctaggtaagtacaaaggttatatagatagtacctaagccgcgtctTTATGTACAGTAACACCATTAGAGTTATAAATCTACATTTGTTTCAAAACATAACATTCAGGTTTTACTAGGCTTTTTTTGGGTTTTTTTGTTTGTTTGTTTGTTTGTTTGTTTTTTGTTTTTTTGGTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTTGAACTCAGAAATCTGCCTGCCTCTGCCTCCTGAGT
This mutation is a 250 bp deletion beginning at Chromosome 9 position 56,241,119 bp and ending after 56,241,368 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47678 | CAC ACC CTG CTC TAT AAA TC | Common | A | Common | ||
| 47679 | GTT CTT GGA TCC CGA GGA GA | Wild type Reverse | A | Wt R | ||
| 47680 | AGC CTA GTA AAA CCT GAA TGT TAT G | Mutant Reverse | A | Mut R | ||
| 47681 | Fluorophore-1 | CAG TCG TGT GAC CCA TGA A | Quencher-1 | WT Probe | ||
| 47682 | Fluorophore-2 | CAA ATT TTT ATG TAC AGT AAC ACC ATT AGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47678 | 0.40 uM |
| 47679 | 0.40 uM |
| 47680 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.