Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr15:21358632+21358731 100bp TCAATAACCAGGAAGGTGTCG CGAATGCAGCTGAGAAACAG
Mutant= 149 bp
Wild Type = 100 bp
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
ATATTTTAAATAATGATTGAAACAAAATAACATAATTTATAAGAACATATGTTAAAGGGATAGACAAGATGgctgaggagttaagggtgcattctgaattatccagccatccacattgaaaatctcaataaccaggaaggtgtcgatattagataagagactattaagtagtaatttaatttatctgataaataaattgtctctctgtttctcagctgcattcggacttggataaaggagagggcactgttaaatacacgctctccggagatggtgctggcactgtttttacaattgatgaaactacaggagacattcatgcaataagaagcctggatagagaagaaaaacctttctacactcttcgtgctcaggcagtggacatagaaaccaggaagccactggagcctgaatcagagttcatcattaaagtgcaggatattaatgacaatgaaccaaagtttttggatggaccttatgttgctagtgttccagaaatgtctcctgtgggtgagtacacaaatcaaatttctatcagatgctattaaccaacagactgcattttcttggtacattttggtgtagatatcttatttataagatatcaatattgttcatttataaaatgttaatatgctctagaaactgtttcctctttctagaatacagacattagaatatgtgcctttttattatttcctaatttattgatttacttgaaataaccatatattatTCAATCAATGATGGAGATAACTATATACCAAATACCGCTGAAAACTATATAGTAATTCTTAGCTCAAATTAAAGTAT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGGATAGACAAGATGGCTG and ATCATTGATTGAATAATATA, which resulted in a 665 bp deletion beginning at Chromosome 15 position 21,358,579 bp and ending after 21,359,243 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340213 (exon 3) and 370 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 6 amino acids later.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
46652 | TCA ATA ACC AGG AAG GTG TCG | Wild type Forward | A | |||
46653 | CGA ATG CAG CTG AGA AAC AG | Wild type Reverse | A | |||
46654 | CAA ACA TCT ATT CTC AAA GAA GCA GT | Mutant Forward | A | |||
46655 | TAG TTT TCA GCG GTA TTT GGT AT | Mutant Reverse | A | |||
46656 | Fluorophore-1 | AGA TAA GAG ACT ATT AAG TAG TAA TTT AAT TTA TCT GAT | Quencher-1 | WT Probe | ||
46657 | Fluorophore-2 | ATA GAC AAG ATG TCA ATC AAT GAT GG | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
46652 | 0.40 uM |
46653 | 0.40 uM |
46654 | 0.40 uM |
46655 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |