Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr11:95752770+95752878 109bp TGGTCTTGTGCCATGAATCT CACACTAGCAGGACAAGCAGA
Mutant= 91 bp
Wild Type = 109 bp
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
AAAATAGAACATACAGAGGTTAGTGTTGGAAGATGAACTGCATGCAGGAATCGTTTTTGTTAGGATTCTGGTCTTGTGCCATGAATCTAAAGTAGATCCATTTCCTCtgccaggaggtaggatggcctcctgaagcctcagtaaataaagattctttctgcttgtcctgctagtgtgtttcctgtaacaaatccttcaagaaactctggtcccttcatgaacatatcaagattgtccatggatatgcagaaaaaaaatttgcctgtgaaatttgcgagaagaagttctataccatggctcatgtacgaaaacacatggttggtgagtctccgcccctctttctccacctgcagactcctggagtgctctctgctccacatTGGGCAGGATATGCAGAGTCAGCATACTGCAGTCAGTTTTAGCTTGTTGAGACTATATGTAGCTTGTCTTTAGTAAGCATGATCAGGTTGGACAGTGCAGTCTTCCCTACCCAGAGT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCATCCTACCTCCTGGCAG and AGTGCTCTCTGCTCCACATT, which resulted in a 273 bp deletion beginning at Chromosome 11 position 95,752,809 bp and ending after 95,753,081 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000674206 (exon 2) and 125 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 299 and early truncation 54 amino acids later.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
46673 | TGG TCT TGT GCC ATG AAT CT | Common | A | |||
46674 | CAC ACT AGC AGG ACA AGC AGA | Wild type Reverse | A | |||
46675 | TCT CAA CAA GCT AAA ACT GAC TGC | Mutant Reverse | A | |||
46676 | Fluorophore-1 | ATG GCC TCC TGA AGC CTC | Quencher-1 | WT Probe | ||
46677 | Fluorophore-2 | CAT TTC CTC TGG GCA GGA TAT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
46673 | 0.40 uM |
46674 | 0.40 uM |
46675 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |