Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr5:35841020+35841129 110bp CAACCACATCCCAGAAGTCC GCAGGGCTGAGTCATAGCA
Mutant= 103 bp
Wild Type = 110 bp
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
TAGGGAGGATGCAGATGTGGTCCTTCAACCACATCCCAGAAGTCCTAGCACCaaggaggggtcagatggactggaaggctgggaatccaatgggcccatactagggccaagggtcttgctatgactcagccctgcctcactgtccagatgtgctctgtttatgcttgaagagcctgttagggttatgttgtttctgcccctgagatctagagggcaaatacagtgggcttggtgaagggcaagccgtgctcctgacccaggttttctcacactgtcttcctaccagggggatcaggatgatcggtcctacaagcagtgcaggacctccagccccagctctgccggctcagtcagcctcggacactacaccccaacctcacggtcaccccagcactacagtcgtccaggtattcacccccaccccactcaccttgacccccgtgaggttgtacttctccatgagtttcctgatacaaagtagcttctttattcattgagaaaagtggaaagggagggtggggggtggtgccggtggggccatggaatgtctggccacttagacatatgggaaagactgcctcaagcctgggagcaggcaaccataAGGCAGCTAGTCACCCTGGGGCTGGAGGAGGTGTCTGAATCCACAGTGCCCATCCCGAGACACACACAGCCCCAAGCTCCACACAGAACAACCAGAGTGGGCTTCTGGGGGCAGTTACAGAGCTGTCAGATGTGAAATTACACACGAGGTAGGAGAGCAAAGCAAGCCACAGTCTGTTGGGAGTCCAT
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAGTCCTAGCACCAAGGAG and CCTGGGAGCAGGCAACCATA, which resulted in a 552 bp deletion beginning at Chromosome 5 position 35,841,047 bp and ending after 35,841,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000185461 (exon 11) and 431 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 350 and early truncation 37 amino acids later
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
46327 | CAA CCA CAT CCC AGA AGT CC | Common | A | |||
46328 | GCA GGG CTG AGT CAT AGC A | Wild type Reverse | A | |||
46329 | CTT GGG GCT GTG TGT GTC T | Mutant Reverse | A | |||
46330 | Fluorophore-1 | CAG ATG GAC TGG AAG GCT G | Quencher-1 | WT Probe | ||
46331 | Fluorophore-2 | CAC CAG GCA GCT AGT CAC C | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
46327 | 0.40 uM |
46328 | 0.40 uM |
46329 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |