Protocol 36189: Probe Assay - Ccdc15<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr9:37302784-37302897 114bp AAAGAGGAGGATTGAAAAGT AGCCCAAACATGGTGATTTC

Mut= 102 bp

Wt= 114 bp

Fam=Mut

Hex=Wt

Sequence

Mut Sequence:

 tctgttagacttctttgcagtatctaaagacgtactgttcttaaagtttCGgtaatggaatgcttgctaacaccaaaggctagaaatcaccatgtttgggct

This mutation is a 13,775 bp deletion beginning at Chromosome 9 position 37,302,836 bp and ending after 37,316,610 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48073 AAA GAG GAG GAT TGA AAA GT Wild type Forward A Wt F
48074 AGC CCA AAC ATG GTG ATT TC Common A Common
48075 TCT GTT AGA CTT CTT TGC AGT ATC T Mutant Forward A Mut F
48076 Fluorophore-1 CTC ATT CTG AGA CTG AAG TAA CCA GTT Quencher-1 WT Probe
48077 Fluorophore-2 CTT AAA GTT TCG GTA ATG GAA TGC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
48073 0.40 uM
48074 0.40 uM
48075 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.