Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr7:45261370+45261473 104bp GCTACAAGCCCTGTTCCTTC CTCGGTTAGCACGTCAGTTCT
Mutant= 110 bp
Wild Type = 104 bp
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
TGACGTCTCTGAGATGTGAGAGCAGGATAGAAAGCAGGAGTCCGAGCACCCAGGGTCTGGGAAAGTGGAGGTCAGGGTTTTGAGCATAACTCGGTGGGTTGGCCAGGCAGGATGTTGGTGGGGAAGGGCAATGACCAGGCGTCTGAGACTCCTAGAAGTAAGAAGGTTGGCCAGTGacggatgcggggcagtcaagccttaaccttgtggcctgagtgagggtgctgctggtgagcagtcttcctagttgcataaagaaggacagacatgagccgaggctctcggaacccttctgccttctctccacaggcagcttctttatagcgtacatcttgatgctgttgggcattgggattccacttctcttcctggagatggcagttggtcagagggcacagcagagcagtgcggacatgtggaagaacctgagcccctggtttggtggagtggggtacagcatggttatggtgaggagccccaggcttcacaaacctgcctgccccacagtgctcctctccctcccctctggagaaaatcccacggctgccctggtgtggaccatgctccttcagcccctccaaactttgtcagtcccttctctctccctgtccctggtcttcctccccagtcatgtctccactggcctgcaggtgtgcttcatcaccaacacctacctgaacgtgttcaattcttggatcctcttctacatgagccacatattctactttgttgtcccatgggaccagtgtcccttacaaaggaattccagtaactttggtgaggaaggagacgtgggagaatgaagggacttgggaagaggaggagagaggagggaggggcacgaagagaaagacaggagaggagggaggcagggggttggggcttgccttatctagcaggcctgtccaaagccatgttcccccagatcctgaatgtgaacaggcaacatcctacacgtacttttggtaccggaagaccttgaaagcctcagacagaattgaggatggagggcaaccgtccttcagcctgggcatgtctctctttctgtccttctgtctcatttgtgctttcttggtcaatgggatcaagtccattgggaaggtgagctgcacttggcccttggcattctcaagtgctacgaccttgttttctccttcctggccagttatccccaaaagctttttttccgagtcctcgtccagcccccttagctctacaaagctgagtcgcttgacaagcagctgatgtgctgccctccccttgtaggtcctgtttgtcttgctactggttccctattccatcatcgtctgcttcctcatccggactctgtcgatggacggcgcagaatacgggcttaagcacctgctgatcctcaaggtgaggttcttcctgggttccctgagctctgggaccagcacggctgcctgctgttgtctcccgtacctcctcctttcccttccctctcatagttgttctctcccaggtcctgatgtccctattgtacctgtcttctcctttttaggtggcgagcatctctgacttaactatttggtgccatgcaggtatccaggtcttgtttgatatcggcctgggctttggccccattgtctccttagcctcacacgtacccgacttcaacaactgtatggccgatgccttcttaatggctctgttcaagataatcaccttactgatgaccacacccttcctcctctccatcctgggcttctgggccactacaactacacatcactgctgtaagaagtaaggccagtccctggcaggtcacaacccattcacacaccttacccgcagggaggctacaagccctgttccttcttatctgagagcagagccccttcctaacattagaaagctccagAGGTCGTCAGGCCGCACCTCAGAACTGACGTGCTAACCGAGGCCAAGAGTGGTAGGGAGGCAAAGGTCACCCCGGCACAGAGA
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGCCAGTGACGGATGCG and CTAACATTAGAAAGCTCCAG, which resulted in a 1706 bp deletion beginning at Chromosome 7 position 45,259,727 bp and ending after 45,261,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001034222 and ENSMUSE00000967546 (exons 4 and 8) and 892 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acids 160.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
46343 | GCT ACA AGC CCT GTT CCT TC | Wild type Forward | A | |||
46344 | CTC GGT TAG CAC GTC AGT TCT | Common | A | |||
46345 | CAG GAT GTT GGT GGG GAA G | Mutant Forward | A | |||
46347 | Fluorophore-1 | AGA GCA GAG CCC CTT CCT AA | Quencher-1 | WT Probe | ||
46350 | Fluorophore-2 | TTG GCC AGT GAG GTC GTC | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
46343 | 0.40 uM |
46344 | 0.40 uM |
46345 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |