Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr3:142536213+142536308 96bp CAGAGCTATTAAGGGTGGAACC CCAGATTGAAGCCTGTGTGA
Mutant= 90 bp
Wild Type = 96 bp
Wt Sequence (deleted region is in lowercase:
ACCTGAATAAACTCAGAGCTATTAAGGGTGGAACCTCTGCctcctgtattgtaaggattcatataaatccatggtgctttcatattctctcacacaggcttcaatctgggcaccacagttaggtctgaaactaagggcatctggatgtggtgtgtgcctcaccccagcaagcccaagttcacactcgtgcttctggacacggagggcttaggagatgtggaaaaggtaggtttggtcttggttctctgtgaaccatttgactgctgctttagtccaacttctgtgctgcttgcaagaattgcaaccaagctattgataaggagaataagttgcttcccttggtgaagtttactcctttgataaactcaaatgttctgttgtaatggaggatagtcttatcttgatacttttgtgaacaatacagttcagttcttaatatttattaagaagctgaattctagtgtttcttactatatgctacaatcctgc
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGAATCCTTACAATACAGG and CTTGCAAGCAGCACAGAAGT, which resulted in a 477 bp deletion beginning at Chromosome 3 position 142,536,240 bp where there is a 4 bp retention TGCA after 142,536,490 and then the deletion continues for 227 bp ending after 142,536,720 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001000161 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 64.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
46338 | CAG AGC TAT TAA GGG TGG AAC C | Common | A | |||
46339 | CCA GAT TGA AGC CTG TGT GA | Wild type Reverse | A | |||
46340 | TCT ACT TCT ATG AAC CCA CAG CA | Mutant Reverse | A | |||
46341 | Fluorophore-1 | TGT AAG GAT TCA TAT AAA TCC ATG GTG | Quencher-1 | WT Probe | ||
46342 | Fluorophore-2 | AAG CAG GCA TAT ACT CTG ACA TCA G | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
46338 | 0.40 uM |
46339 | 0.40 uM |
46340 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |