For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 033436
Protocol 35465: Probe Assay - Slc38a6<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:73292209+73292347 139bp CTGCTTGCCATGTGCATC CCTGTTTGTGCTTGCTAAATACG
Mut= 124 bp
Wt= 139 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CACATAGAGCCTAGGAATCGTCAGCTCGACAGTACAGGCAAAGCCATGGTTACAGGGCCCACATCACTGGAAGGAGAGGGAGTTGGGGAAATGGGGCAAGAGTAAGTCATTGAGACTTAGAACAGGAAAATTAGTCACTAAAGGGAAATATTTAAATCACTGAGTGCTGAAATGCAGTCAGCAGACagtgcaaagtgagggacttgtgttttaagtaaagtttctttctttctgacttcacttttcattttaaaagcatttcatttgacttaagtacaagtcggtaaatacagaacagtgatttctttgatgtctgcagctctgcttctcagagacggtccctacaagcatctgactgaagaaatgacggatcatgaaaaagcaagcttggaggaaacctaacggtgttgttttatgttttagtttcctgctgctgtttgttgctctcctggcttcttactcagtccatctcctgcttgccatgtgcatccacaccggtgagtaacaccatgctgctcacttgacccagcctcgtgcataagaaatgaatgtctcccctctgaTGTGTGAGAGTCAAACGAAAGCGTACGTATTTAGCAAGCACAAACAGGCCCCAGGCTTGGAACTCCAGCACCAACACGCCCCAAGCGTCTGGTTTCCAATGAGCATATATCATTAATGGTGTGGTGATTGGTTTTGTTTTCTTGTGTTAAGGACAAAAG
This mutation is a 377 bp deletion beginning at Chromosome 12 position 73,291,923 bp and ending after 73,292,299 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46131 | CTG CTT GCC ATG TGC ATC | Wild type Forward | A | |||
| 46132 | CCT GTT TGT GCT TGC TAA ATA CG | Common | A | |||
| 46133 | TGA GAC TTA GAA CAG GAA AAT TAG TCA | Mutant Forward | A | |||
| 46134 | Fluorophore-1 | ACA CCA TGC TGC TCA CTT GAC | Quencher-1 | WT Probe | ||
| 46135 | Fluorophore-2 | ATG CAG TCA GCA GAC TGT GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46131 | 0.40 uM |
| 46132 | 0.40 uM |
| 46133 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.