For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 033432
Protocol 35453: Probe Assay - Tom1l1<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:90683173-90683261 89bp CACAAAGAAATCCAACTTTCCT AAGAATGTTAATTGTAGGGGTGAA
Mut= 85 bp
Wt= 89 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AAGAATCTTAAAGGGATCACTTTTCTCTTGTTGTTTTAGGGTTACATTTCCTGTAACCCGATTCTGTGTGTGTATAGAAGCCAGTGTGTACACACTTCATGACTGTTTATGTAATCCTCTTGCACACATATCTTAGCTGTGTCTCCCCAGGGGGCAGGTGGTGTGATCTATCAATtttggaaggcagcttagagatggtgcgctaagtggcccagctaagacagaaacacaatcaaacattggcctgtacgcttaagccattcctatttccgtattgtacactgcttccatagagactgcctctctatccaaattgttcatttcagtgtctttattgccataggccaaaagatgcagtaaaagctttgaagaaaaggatctccaaaaactataaccacaaagaaatccaactttccttatcagtaagtacttttaatgctataaataagattgcgggggTTTCACCCCTACAATTAACATTCTTTTTTGTTTGTTTGTTTTTGTTTGTTTGTTTTGTTTTGTTTTTGCTTTTTGTTTTTCAAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATT
This mutation is a 284 bp deletion beginning at Chromosome 11 position 90,683,198 bp and ending after 90,683,481 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46100 | CAC AAA GAA ATC CAA CTT TCC T | Wild type Forward | A | |||
| 46101 | AAG AAT GTT AAT TGT AGG GGT GAA | Common | A | |||
| 46102 | CCT CTT GCA CAC ATA TCT TAG CTG T | Mutant Forward | A | |||
| 46103 | Fluorophore-1 | ATG CTA TAA ATA AGA TTG CGG GG | Quencher-1 | WT Probe | ||
| 46104 | Fluorophore-2 | AGG GGG CAG GTG GTG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46100 | 0.40 uM |
| 46101 | 0.40 uM |
| 46102 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.