For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 033299
Protocol 35157: Probe Assay - Cwh43<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:73411749+73411845 97bp TGTGCTAATTCTACCTTCTTCAGG ACAGGGAAAGGAAGGGTGAG
Mut= 95 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTTGGCAGGGGGTGGAGAGAATGTTCTAAAATTAGCGGTGATAGTTGACAACTTTGAATGTACCCAAAACCTATTAAGTTGTATATTTTAACGTTGCGAACCTTATATGAGAATCCTACCTAAATGAATAAAGATTAAAGGTATGTATAGGTATGTGCTAATTCTACCTTCTTCAGGGCTAAGACcgtactagacacagttcttatcaaatgcagactgtcaggtgccagctcacccttcctttccctgtttgtaggcagcatagcttcctttgaggctccaaatgctaagcttcgactgatggtcctcgcccttggtgtgtcttcttccctgatagtgcaaactgtgacctggtggtcaggaagtggattgcaaaggtatgactcaggtgttttgtacctatagacaaacaggtgtgaccagtttccctggcgaagttctgacCATTGGTTTCAGGGCAGTTTTCCCATTCCTTTTCAAAAAATAAAGGTTCAAATACTTGCCACCAATGTCATTTGCTTTTGGTGCTAGGGACCGAACTCAGGTGTTGTGTGTATTTAGTTTCTCCCTGCTGTTTTGCTGTACTTCCAGCCCCAATAAAGTATAAACAT
This mutation is a 259 bp deletion beginning at Chromosome 5 position 73,411,781 bp and ending after 73,412,039 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45400 | TGT GCT AAT TCT ACC TTC TTC AGG | Common | A | |||
| 45401 | ACA GGG AAA GGA AGG GTG AG | Wild type Reverse | A | |||
| 45402 | GGT GGC AAG TAT TTG AAC CTT | Mutant Reverse | A | |||
| 45403 | Fluorophore-1 | ATC AAA TGC AGA CTG TCA GGT G | Quencher-1 | WT Probe | ||
| 45404 | Fluorophore-2 | CAG GGC AGT TTT CCC ATT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45400 | 0.40 uM |
| 45401 | 0.40 uM |
| 45402 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.