For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 033080
Protocol 35872: Probe Assay - Rbbp8nl<em1(IMPC)J>Alternate2
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 100 bp
Wild Type = 101 bp
>chr2:180283515-180283615 101bp AGCCACTTTTAGAACCAACCTCT GGACACCCCATCTACACCTC
Sequence
Wt Sequence AGACAGGTCCAGGAGAAGTTAAGGGTGTATGTAGCTTCCCTTCCCTACCCCTCAAAAAGTAGCCCCTCTTGGATACTCTGCCCCTCCAGATGGCCAGCCACTTTTAGAACCAACCTCTAAtcagatgctaagctagagtcccaggccacagctcaggaaaccaggacatctgggcagaggtgtagatggggtgtcctctccacacctttcccagggtctgcttccaagagtcaggcggatatcaggggtctggagatgctaaccagggcaagagtttccatggcccgcctcagccctaccccggctgtgagggggcagctgggcggggcctgacttgcactttctctgtcctctctgccagGTCTGCAGAACAAGCTTCTAGAACTGAACTCAGAACGGTGCCGgtgagtgagcccagcccagccagaggagcagatgggagggcagctatccccacaagccatagtcaccaacactgcccatgaggtcccaggatggcagctcacccagtgtcccaaatgaaGAAGGGAAACTGAGGTTTAGCATGGCAGGGAGGGGGCAGCGAGTCCCTTGGCCAAGGTGACATACTACTCAAGTGACAGACCATTGAGACATCAGTCTCAAGCGGTCTGACATGGCCCTCCACTTGGGAACCAA
Mut Sequence ggagaagttaagggtgtatgtagcttcccttccctacccctcaaaaagtagcccctcttggatactctgcccctccagatggccagccacttttagaaccaacctctaAGaagggaaactgaggtttagcatggcagggagggggcagcgagtcccttggccaaggtgacatactactcaagtgacagaccattgagacatcagtctcaagcggtctgacatggccctccacttgggaacc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44413 | CAC TTG AGT AGT ATG TCA CCT TGG | Mutant Reverse | A | |||
| 44414 | AGC CAC TTT TAG AAC CAA CCT CT | Common | A | |||
| 44415 | GGA CAC CCC ATC TAC ACC TC | Wild type Reverse | A | |||
| 47211 | Fluorophore-1 | AGC TCA GGA AAC CAG GAC ATC | Quencher-1 | WT Probe | ||
| 47213 | Fluorophore-2 | AGG TTT AGC ATG GCA GGG AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44413 | 0.40 uM |
| 44414 | 0.40 uM |
| 44415 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.