For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chrX:9913578+9913712 135bp GGAAGACATTCCTAACAAGGGTA ACACAGGACTAGAGTAGAGAACAAAGA
Mutant= 136 bp
Wild Type = 135 bp
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
A 544 bp deletion beginning at Chromosome X position 9,913,615 bp and ending after 9,914,158 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
44366 | GGA AGA CAT TCC TAA CAA GGG TA | Common | A | |||
44367 | ACA CAG GAC TAG AGT AGA GAA CAA AGA | Wild type Reverse | A | |||
44368 | AGC TTC TAT GAA ATC CCA GCA | Mutant Reverse | A | |||
44369 | Fluorophore-1 | CTG AAT ATC ACA CTA ATG AAG TCA GTA GAA A | Quencher-1 | MUT Probe | ||
44370 | Fluorophore-2 | CCT CTC GAT TAG TTT TCC CCT | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
44366 | 0.40 uM |
44367 | 0.40 uM |
44368 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |