For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chrX:142770869+142770978 110bp CATGTGGGCTGTTTTCCAC TGCATCTGTAACCTGGAGGA
Mutant= 85 bp
Wild Type = 110 bp
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
A 340 bp deletion beginning at Chromosome X position 142,770,892 bp and ending after 142,771,231 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
44376 | CAT GTG GGC TGT TTT CCA C | Common | A | |||
44377 | TGC ATC TGT AAC CTG GAG GA | Wild type Reverse | A | |||
44378 | TTG CAA AGC GTA CAA AGG TTC | Mutant Reverse | A | |||
44379 | Fluorophore-1 | TGT CTG AGC CCT TCG TTC TT | Quencher-1 | MUT Probe | ||
44380 | Fluorophore-2 | CTC GCA CAT GGC TTA GCT C | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
44376 | 0.40 uM |
44377 | 0.40 uM |
44378 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |