Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr19:4232328+4232420 93bp TCCGATGAGCTGTCTGTCTG TGCCCTACCCTGGACTTAGA
Mutant= 106 bp
Wild Type = 93 bp
TTGGCTAAAAAGGGAAGCTAGCATGTCTCGCACTTCCGATGAGCTGTCTGTCTGCTGGATGGCAAAGgcaaatgggtggggagattgccaggatatagagtcacagctctaagtccagggtagggcaaaggcctggatgtgcctgaggagccaccacatgttattgcaggggaagacACCCAgtccctcagccaggaggaaacagagctggagctgctgaggcagtttgacctggcctggcagtatgggccttgtacaggtgagcaccccatttccagtccctcccatcaggcacatctctgaatcagttctgttatcaatgtgtctcaaaagtaatcctgcctagctcttggacactgtctcctgaaactgactatggaggctcaagaaactgccgtccatgtccactatcctggattctcctgcctatcctgtcttcttttcctgatggcaggtatcacaaggctgcagcgctggagtcgggcagagcagatgggcttgaagccccccctagaggtgtaccaagtgttgaaggcacaccctgaagaccctcacttccaatgcaggtcaggataggctgggacagctttcaggggaaccagggacttctccaggagctgccaccctcTTGGTCTACGTAGGGGCTACCTTGACTTGGAGAAGTGGGAACAGACTTAGACGGTCCTTCCTGTCAAGCAAGAAGAGTCTGGCT
A 2-part deletion beginning at Chromosome 19 position 4,232,361 bp for 446 bp, followed by 5 bp of retained sequence (TGGGT), then an additional 110 bp deletion that ends after 4,232,921 bp (GRCm38/mm10).
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
44356 | TCC GAT GAG CTG TCT GTC TG | Common | A | |||
44357 | TGC CCT ACC CTG GAC TTA GA | Wild type Reverse | A | |||
44358 | CTT GAC AGG AAG GAC CGT CT | Mutant Reverse | A | |||
44359 | Fluorophore-1 | AGA TTG CCA GGA TAT AGA GTC ACA G | Quencher-1 | WT Probe | ||
44360 | Fluorophore-2 | AGA CCC ATT GGT CTA CGT AGG G | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
44356 | 0.40 uM |
44357 | 0.40 uM |
44358 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |