For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:64389119-64389220 102bp CAGCCTTTGCTAAGTTGTGC ACATCACCACTACCCCACCA
Mut= 100 bp
Wt= 102 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATACTCTATTTTACCTGTAGGTCTCAATCCCATTTCAGATATCATATCCTTAGATAATTTTTCTCAAGCTTAAAGCCAGGTGGGAATCACTTGCCAAACGACTAATAGGTGAGGAGTATGTATGATGCAGATTTGAGGATTTAAGGCTGACTTCCTGGgtatctccaggcaagtagatgcgtaagcttcagtatatacagcaaagtcaggtttttagtttttacggtctggctcatcagcagggtactgttgggaactagagtctgtacttaaaattgatgcttcatttacattttaatttgcaaatacgatatgtctttttcttttatttaaaaatgcttgatgctattgtgtataattcattctcacttaattttctttccaatagaattcagaatggactagcatcaaacttcacatctttaacaaaagttctatatgattttaataaagtattagagaatggccgaatctctggaagtcctttacagaaacttgagataaacagttttgatgatgagcagatttggcaacaactcgaattgcaaaatgaacctgtcttacaatacttccagaatgcagttagtgagacagttgaggatgaagatatcagccttctcccagaatgtgaagatgaggagtgcgaagaggatgcctcagaggtggaggctgacaaccaggagaacctagagacagacttggatgaagaacaactgtcagacgagggtggtgatgttcctaaagggagggacagagccaaaagctccaggaaatctgacccaaggaaaagtccagttttcagtgatgaagattctgaccttgactttgatattggcaaattggagcagcagaccaagatgcaaatcaagccacctggaaaaccaagagaaaagtctgtcgtagatgataagttcttcaaactgtctgaaatggagagcttcttagaaaaagtagaaaaagaagaggaaaaaagaccagatggtgaagaggaggacgaggaagacattgacctttttgaagacattgattcagatgaaagcgagggagggctgtttgggcggcagaagattaaggtaatgttttggaaaaaaacaaaaactgtttctttaaagtacaagtcatgttttcctacagagaaatgtaatgtgcctcagacctcatttgagcccaaatgaagtaaggaaaaaacaaacaaacataaagaaataaattaaaattaagagctgagccagtggtgcaggagtgtagtaatcctcagaagtgggaggctgaggcaggaagattgtggcttctcaaagccagcctttgctaagttgtgcttcagttgtccttatggttttatggtgGTCAACTAGTTGCCAGTTTCCCTAATAACTATTTCTGGTGGGGTAGTGGTGATGTTAGGAACCAGTTTGTGTGTGTAATATACATAGGCACATGAGTATGTTTATATATTTTTTTATCTTTAAACTTTTCAAAAATGTTTTTTATTTTAGTCAAATAAA
This mutation is a 1188 bp deletion beginning at Chromosome 7 position 64,389,174 bp and ending after 64,390,361 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44000 | CAG CCT TTG CTA AGT TGT GC | Wild type Forward | A | |||
| 44001 | ACA TCA CCA CTA CCC CAC CA | Common | A | |||
| 44002 | GAG TAT GTA TGA TGC AGA TTT G | Mutant Forward | A | |||
| 44003 | Fluorophore-1 | CAG TTG TCC TTA TGG TTT TAT GGT G | Quencher-1 | WT Probe | ||
| 44004 | Fluorophore-2 | AGG CTG ACT TCC TGG GTC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44000 | 0.40 uM |
| 44001 | 0.40 uM |
| 44002 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.