For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr11:113703640-113703758 119bp CCTTGTTTGGCAGTTGCAG TGCGTTAGGGGTGAGCTTG
Mut= 120 bp
Wt= 119 bp
Fam=Mut
Hex=Wt
Mut Sequence:
ccttgtttggcagttgcaggcggcccgtgcctccaaggctgcctccttgtagaaatgcagctgaccaaggtccacagggcctgattgggggtcggtggggagggtacatgcctgcaatcc
This mutation is a 3917 bp deletion beginning at Chromosome 11 position 113,699,772 bp and ending after 113,703,688 bp (GRCm38/mm10). In addition, there is a 2 bp (TC) insertion at the deletion site.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
43571 | CCT TGT TTG GCA GTT GCA G | Common | A | |||
43572 | TGC GTT AGG GGT GAG CTT G | Wild type Reverse | A | |||
43573 | GGA TTG CAG GCA TGT ACC | Mutant Reverse | A | |||
43574 | Fluorophore-1 | TCA CCG CAT AGA CAC AGC C | Quencher-1 | WT Probe | ||
43575 | Fluorophore-2 | AGG TCC ACA GGG CCT GA | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
43571 | 0.40 uM |
43572 | 0.40 uM |
43573 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |