For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032600
Protocol 37798: End Point Analysis Assay - Plp1<jp>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =G/G
Heterozygote = A/G
Wild type = A/A
chrX:136834117+136834201 85bp CTTATGAAGTTTACTCTGGCTGCT GTTGGAGCCACAAACCTTG
Sequence
SEQ
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 52184 | CTT ATG AAG TTT ACT CTG GCT GCT | Forward | A | |||
| 52185 | GTT GGA GCC ACA AAC CTT G | Reverse | A | |||
| 52186 | Fluorophore-1 | ATG TAT CTT AGG TGT TCT CCC ATG G | Quencher-1 | WT Probe | ||
| 52187 | Fluorophore-2 | ATG TAT CTT GGG TGT TCT CCC ATG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 52184 | 0.40 uM |
| 52185 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.