For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032556
Protocol 33761: Probe Assay - Tnrc6c<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:117702466+117702563 98bp CTTTGCAATGGTGTGACTTTTG GGCTCTATTCTGGCCTTTGT
Mut= 105 bp
Wt= 98 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGGCCAGCCTGCTCTGCACAGTGAATTCCAGGACAGTCAAGGTTCCATGTCTCAAAGAAACTAAGGAAAAAAAAAAAAAAAAAACCCTAAAATACTTAGAAGTTTGCTTATAAACCTTCATCAGTGTGGACATTGCTACAATTGTTTCTAAAGAAGTTCTGATTTTTTTTTTCAGGCTGCTGATCAAAAAACcaaaggtaagtatgtttgtttgtttatttttatactttgtgaggggcatactttttatagtagtatcaaactttgcaatggtgtgacttttgtaaaatttatgtttataggtgttttgcctacatgtttgtctgtgtacCAAGTGTGTACAAAGGCCAGAATAGAGCCTTGGATCTCCTAGACCTGGAATTGAGATAGCTGTGAGCCACCATGTGTGTGCTATTAAATACTTCTTTTTGTCTTCCCTTGGACACAATTGCACATGTAGATACTTGCATTGTAAGGACTTTTGCAAAG
This mutation is a 139 bp deletion beginning at Chromosome 11 position 117,702,396 bp and ending after 117,702,534 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42148 | CTT TGC AAT GGT GTG ACT TTT G | Wild type Forward | A | |||
| 42149 | GGC TCT ATT CTG GCC TTT GT | Common | A | |||
| 42150 | TTC ATC AGT GTG GAC ATT GCT AC | Mutant Forward | A | |||
| 42151 | Fluorophore-1 | AGG TGT TTT GCC TAC ATG TTT GT | Quencher-1 | WT Probe | ||
| 42152 | Fluorophore-2 | CTG ATC AAA AAA CCA AGT GTG TAC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42148 | 0.40 uM |
| 42149 | 0.40 uM |
| 42150 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.