Stock No: 032542
Protocol 33778: Probe Assay - Glb1<em(Y155Y,L156R)Lutzy>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  T, G

Wild Type = C, T

Sequence

Wt Sequence (bp changes in parentheses with wt first):
 
cacacactaaccatatgacaagctagttgacaaaggcttgcgacagttgccacaccatcctgttttgcagACTA(c/t)C(t/g)TGTAGCTGTGGATAAATGGCTGGCAGTCCTTCTGCCCAAGATGAAGCCCCTGCTCTACCAGAACGGAGGACCGATCATAACCGT
 
Nucleotide in red is a potential SNP (rs33636238)

Y155Y,L156R

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
42170 CAC ACA CTA ACC ATA TGA CAA GC Forward A
42171 ATC TTG GGC AGA AGG ACT GC Reverse A
42172 Fluorophore-1 TTT TGC AGA CTA CCT TGT AGC TGT G Quencher-1 WT Probe
42173 Fluorophore-2 TTT GCA GAC TAT CGT GTA GCT GTG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
42170 0.40 uM
42171 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.