Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr17:25858923-25859004 82bp GATGGGTTTGTTCCTGTTGC AGTCTTCTGGCTGCAGTGGT
Mut= 82 bp
Wt= 82 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletions in lower case):
GGATGAGAAGAGCTGTTCCCCCCCAGAAGCAGGTGGGCTGTGGTTCGACAGGGTGCACAGGGCTTGGTGGGAACAGTTTTGGGGCATCCTGAATGAGGATCAGTAGCATGGAGACTACACATGGTATGTGCCTGGGGCAGCCTGGAAATAggcccagagaagGGCGGAGCTGGTGGCCCTctgaggtcctagaatcgtaaggtccatgcaagtggcatctggtctccaagctttcgtgttggagagactctgccagagtttaggatagaatggtggcagcgtttatggaatagcatctgtagaatggtgaggggaacctcctgttcctccctgcaccttggctgacatcctcatgggtcctcttgctgctcctccctggctctttgctccattgtagtcttcctaggtcgtatgtcacggcacctgcctcatccaggggtcttgggcaaacctttgctgagcagtaagtcccctgtggcccaggcatgtagctctgcattggtgagtgcgcttgggaaagggctggggaccggtgcccctaagggtgctgatggcacatgttccattacagccatgccaggtcctttcagcatctagtcgccttccagaggtcagccggacctacaggtatcgagaagtctccagtgtaagtgcctccagcatccagagccaacgtccttcagttcgcgatgaggttcccgatgcacacacggtgtccggcgagagacacgttcttgctgacagatcatctggcgtgcccatggcccttgaggacattggttcctgtagggtgagtgcccatctgaaggcattgggcattagtgagataacaggctggctaacctgagcctcctgagatgcatccagagtggatgggcctctagagatgggtttgttcctgttgccaattctgtcaaaggacaggacctggggtttctaaagactttaccactgcagccagaagactgcttctagcaggagttctttgtacctccccaccttttatttgagaggcagcacaagtggggcattcgcaggggatagagtgacttcccccagtctcattttgcattttcctatttcagcttttcctcccagacccagtcctgaggctcaagggcgtcatcggttttgggggtcacagcacccaatgggtgaggttcccaggccagttttgattgggtgggacgagtgagttttagggaaggaaagattcctagttctgtctcgggcactttctttcctcaagaaaccctgccctgcccacctcttattcctgagggctaatgtgagtctttaggtcatgggtgccctctgttcacttggtaaggtctgctgggctaaagggctcccaaagacccaagagcTCTGagatacggatgtgtgtgtgtgtgtgtaaaattttttaagattattttatggggctggagaggtGGCTCACTGGTTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCAGCAACCACATGGTGGCTCACAACTATCTGTAATGAGATCTGATGCCCTCTTCTGGGGTGTCTGAAGACAGCTACAGTATACTTACATATAATAAATACATCTTTAAAAAAAAA
This mutation is a 1250 bp deletion beginning at Chromosome 17 position 25,858,456 bp for 1187 bp followed by an endogenous 4 bp retention (TCTG) then an additional 63 bp deletion ending after 25,859,709 bp (GRCm38/mm10). In Addition, eighteen bp before the exon deletions there is an 11 bp deletion that will not alter the results of the exon deletions.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
41649 | GAT GGG TTT GTT CCT GTT GC | Wild type Forward | A | |||
41650 | AGT CTT CTG GCT GCA GTG GT | Wild type Reverse | A | |||
41651 | GAA ATA GGC GGA GCT GGT G | Mutant Forward | A | |||
41652 | GGA TTT GAA CTC AGG ACC TCT G | Mutant Reverse | A | |||
41653 | Fluorophore-1 | AGG ACA GGA CCT GGG GTT T | Quencher-1 | WT Probe | ||
41654 | Fluorophore-2 | CCT TCT GGG CTC ACT GGT T | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
41649 | 0.40 uM |
41650 | 0.40 uM |
41651 | 0.40 uM |
41652 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |