Protocol 33540: Probe Assay - Wdr90<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:25858923-25859004 82bp GATGGGTTTGTTCCTGTTGC AGTCTTCTGGCTGCAGTGGT

Mut= 82 bp

Wt= 82 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletions in lower case):

GGATGAGAAGAGCTGTTCCCCCCCAGAAGCAGGTGGGCTGTGGTTCGACAGGGTGCACAGGGCTTGGTGGGAACAGTTTTGGGGCATCCTGAATGAGGATCAGTAGCATGGAGACTACACATGGTATGTGCCTGGGGCAGCCTGGAAATAggcccagagaagGGCGGAGCTGGTGGCCCTctgaggtcctagaatcgtaaggtccatgcaagtggcatctggtctccaagctttcgtgttggagagactctgccagagtttaggatagaatggtggcagcgtttatggaatagcatctgtagaatggtgaggggaacctcctgttcctccctgcaccttggctgacatcctcatgggtcctcttgctgctcctccctggctctttgctccattgtagtcttcctaggtcgtatgtcacggcacctgcctcatccaggggtcttgggcaaacctttgctgagcagtaagtcccctgtggcccaggcatgtagctctgcattggtgagtgcgcttgggaaagggctggggaccggtgcccctaagggtgctgatggcacatgttccattacagccatgccaggtcctttcagcatctagtcgccttccagaggtcagccggacctacaggtatcgagaagtctccagtgtaagtgcctccagcatccagagccaacgtccttcagttcgcgatgaggttcccgatgcacacacggtgtccggcgagagacacgttcttgctgacagatcatctggcgtgcccatggcccttgaggacattggttcctgtagggtgagtgcccatctgaaggcattgggcattagtgagataacaggctggctaacctgagcctcctgagatgcatccagagtggatgggcctctagagatgggtttgttcctgttgccaattctgtcaaaggacaggacctggggtttctaaagactttaccactgcagccagaagactgcttctagcaggagttctttgtacctccccaccttttatttgagaggcagcacaagtggggcattcgcaggggatagagtgacttcccccagtctcattttgcattttcctatttcagcttttcctcccagacccagtcctgaggctcaagggcgtcatcggttttgggggtcacagcacccaatgggtgaggttcccaggccagttttgattgggtgggacgagtgagttttagggaaggaaagattcctagttctgtctcgggcactttctttcctcaagaaaccctgccctgcccacctcttattcctgagggctaatgtgagtctttaggtcatgggtgccctctgttcacttggtaaggtctgctgggctaaagggctcccaaagacccaagagcTCTGagatacggatgtgtgtgtgtgtgtgtaaaattttttaagattattttatggggctggagaggtGGCTCACTGGTTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCAGCAACCACATGGTGGCTCACAACTATCTGTAATGAGATCTGATGCCCTCTTCTGGGGTGTCTGAAGACAGCTACAGTATACTTACATATAATAAATACATCTTTAAAAAAAAA

This mutation is a 1250 bp deletion beginning at Chromosome 17 position 25,858,456 bp for 1187 bp followed by an endogenous 4 bp retention (TCTG) then an additional 63 bp deletion ending after 25,859,709 bp (GRCm38/mm10).  In Addition, eighteen bp before the exon deletions there is an 11 bp deletion that will not alter the results of the exon deletions. 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
41649 GAT GGG TTT GTT CCT GTT GC Wild type Forward A
41650 AGT CTT CTG GCT GCA GTG GT Wild type Reverse A
41651 GAA ATA GGC GGA GCT GGT G Mutant Forward A
41652 GGA TTT GAA CTC AGG ACC TCT G Mutant Reverse A
41653 Fluorophore-1 AGG ACA GGA CCT GGG GTT T Quencher-1 WT Probe
41654 Fluorophore-2 CCT TCT GGG CTC ACT GGT T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
41649 0.40 uM
41650 0.40 uM
41651 0.40 uM
41652 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.