Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr1:55084911-55085025 115bp TCTGGGATTTGGCGATTAAC CACTGATCATTTGCCAGGAG
Mut= 117 bp
Wt= 115 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletions in lower case; and insertions with carrots ^g^ (G at first insertion, GTCTC at second):
TCAGAAAACAAAATAAACCTAGGTCATAGCCAAAACTCAAGTGCAAATGATGTGAAGAGTGTTCTGGGATTTGGCGATTAACATCTGTGCTTTCTTGTTTTATGGGTGGCATCTGTTA^gtaccagggaattcctgttgtgcttcattcaatgttggactcctggcaaatgatcagtgctcattttttatagacctaagatggttgattaacgtggctttgagattcatgttgcaggatggttaaaaatgacaaatttgagggttatcattgagggttgctttttttttccctgtcgctgtagggaagaactgtgattattgaacagagttggggaagtcccaaagtaacaaaagatggggtcactgttgcaaagtcaattgatttaaaggataaatacaaaaatattggagctaaacttgttcaggacgttgccaataacacaaacgaagaggctggggatggcaccaccactgccactgttctggcacgatctattgccaaggagggctttgagaagatcagcaaaggggctaatccagtggaaatccggagaggtaagagtatatcattgatcttatcctgtaaa^GAATTCTGTTGTCTTTATCTTTGTCCTTT^ttat^TACATTCGTTGTAGAGTTTGTGAGTGTTCATTCTTGGTGGAATTGCCCTTTCCTTACTTATGTGGGTTTCCAA
This mutation is a 469 bp deletion beginning at Chromosome 1 position 55,084,501 bp and ending after 55,084,969 bp (GRCm38/mm10). In addition, there is a single bp insertion (G) at the deletion site as well as an indel with a 5 bp insert (GTCTC) and 4 bp deletion (TTAT) 29 bp after the 469 bp deletion that will not alter the results of the deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
41612 | TCT GGG ATT TGG CGA TTA AC | Common | A | |||
41613 | CAC TGA TCA TTT GCC AGG AG | Wild type Reverse | A | |||
41614 | CAC TCA CAA ACT CTA CAA CGA ATG | Mutant Reverse | A | |||
41615 | Fluorophore-1 | CCT GTT GTG CTT CAT TCA ATG T | Quencher-1 | WT Probe | ||
41616 | Fluorophore-2 | TGG CAT CTG TTA GGA ATT CTG TT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
41612 | 0.40 uM |
41613 | 0.40 uM |
41614 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |