Protocol 33528: Probe Assay - Mical3<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:121040534-121040657 124bp TGGACATAGGGGTGAATGTG AAGGACAAGTCGATGGCTGT

Mut= 134 bp

Wt= 124 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletions in lower case; and insertion with carrots ^g^ (GATC insertion):

 TAATCTACCCTTTGGCAGCAACCTTAGAGACTTCCTAAGGGTCCCTGTCTTGATAAAAGATGAGATGTGATTTTCATGCTGTTGGTTTAGATGATGCCCCA^tttaa^GTTTTGCCGATCTACGGGTTCTCTAAGCTGCTTGAGGTAGACATGCCAGgggttcagtcttcccagcccaccaagcatgagctcgtccttcaagcctctgcaaggactcagtggtccgagtcaggcttccagcgtcttggtcctggagtttggacataggggtgaatgtgggacttgagaggcgtggccttggccctgagagcacctgtatctttcagtgtctcatcattggagctggcccctgtgggctgcgcacagccatcgacttgtccttgttgggagccaaggtggttgttattgaaaagcgagatgccttctcccgcaacaatgtcttacatctctggcccttcaccatacacgatctccgaggcctgggtgccaagaaattctacggcaagttctgtgccggagccatcgaccatatcagtgagtaacactggctcttcttgctttccttcttcggtgggttaagtgaggacttcctcctcacccagcatttgcacccgccaccctggtctataacctgccttcttaaccaagtggggctcttgtacaaaaggagttaaagtttgctttaaagatccttaattgggggccaggtttggtggtgcgcacttttaatcccagcactcagacagattgtgagttcaagaccagcctgttctacagagagaattctaggacagccagTACTACAACAGAGAAACCATGTCTCCACAAATTTTTGGTTGGGTCTTGGACTCTTCCTGAGTACCCATGGTATATGCAGTTCAGTTGAAGGGAAGGGTGGGCATTGAGAATAAGGTAGACAGGTTGGATTT

This mutation is a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10).  In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion. 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
41617 TGG ACA TAG GGG TGA ATG TG Wild type Forward A
41618 AAG GAC AAG TCG ATG GCT GT Wild type Reverse A
41619 AGC TGC TTG AGG TAG ACA TGC Mutant Forward A
41620 TTC TCA ATG CCC ACC CTT C Mutant Reverse A
41621 Fluorophore-1 ACT TGA GAG GCG TGG CC Quencher-1 WT Probe
41622 Fluorophore-2 CAG TAC TAC AAC AGA GAA ACC ATG TCT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
41617 0.40 uM
41618 0.40 uM
41619 0.40 uM
41620 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.