Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr6:121040534-121040657 124bp TGGACATAGGGGTGAATGTG AAGGACAAGTCGATGGCTGT
Mut= 134 bp
Wt= 124 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletions in lower case; and insertion with carrots ^g^ (GATC insertion):
TAATCTACCCTTTGGCAGCAACCTTAGAGACTTCCTAAGGGTCCCTGTCTTGATAAAAGATGAGATGTGATTTTCATGCTGTTGGTTTAGATGATGCCCCA^tttaa^GTTTTGCCGATCTACGGGTTCTCTAAGCTGCTTGAGGTAGACATGCCAGgggttcagtcttcccagcccaccaagcatgagctcgtccttcaagcctctgcaaggactcagtggtccgagtcaggcttccagcgtcttggtcctggagtttggacataggggtgaatgtgggacttgagaggcgtggccttggccctgagagcacctgtatctttcagtgtctcatcattggagctggcccctgtgggctgcgcacagccatcgacttgtccttgttgggagccaaggtggttgttattgaaaagcgagatgccttctcccgcaacaatgtcttacatctctggcccttcaccatacacgatctccgaggcctgggtgccaagaaattctacggcaagttctgtgccggagccatcgaccatatcagtgagtaacactggctcttcttgctttccttcttcggtgggttaagtgaggacttcctcctcacccagcatttgcacccgccaccctggtctataacctgccttcttaaccaagtggggctcttgtacaaaaggagttaaagtttgctttaaagatccttaattgggggccaggtttggtggtgcgcacttttaatcccagcactcagacagattgtgagttcaagaccagcctgttctacagagagaattctaggacagccagTACTACAACAGAGAAACCATGTCTCCACAAATTTTTGGTTGGGTCTTGGACTCTTCCTGAGTACCCATGGTATATGCAGTTCAGTTGAAGGGAAGGGTGGGCATTGAGAATAAGGTAGACAGGTTGGATTT
This mutation is a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10). In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
41617 | TGG ACA TAG GGG TGA ATG TG | Wild type Forward | A | |||
41618 | AAG GAC AAG TCG ATG GCT GT | Wild type Reverse | A | |||
41619 | AGC TGC TTG AGG TAG ACA TGC | Mutant Forward | A | |||
41620 | TTC TCA ATG CCC ACC CTT C | Mutant Reverse | A | |||
41621 | Fluorophore-1 | ACT TGA GAG GCG TGG CC | Quencher-1 | WT Probe | ||
41622 | Fluorophore-2 | CAG TAC TAC AAC AGA GAA ACC ATG TCT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
41617 | 0.40 uM |
41618 | 0.40 uM |
41619 | 0.40 uM |
41620 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |