For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032338
Protocol 33367: Probe Assay - Slc41a2<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:83300864-83300969 106bp CCATCTATCCATCCATCCATC CAGGAGGCAGAAGGTGGTAG
Mut= 106 bp
Wt= 110 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCCTCACTCCACACCTGTTGACACAGATCAGGGCATTTGGAGAGCCCACTGTCTTAAGTGGTAATAAAACTAAAACCCAGGAGCCCCTTCAAAGTGAAAGCAGTTCAGTAAACCATACCCAGCACCctaatgatcttgtatgtaatgattaactaatgatagtttaatgttttaaaaattactaatctggatttcacaaaaatgtttttaggttcaggccacagtggttggctttttagcagctgtggcagccatcatactgggctggattccagaagggaagtattacctcagccattccatacttctgtgctccagcagtgtggcaacggccttcatcgcatctctactgcagggtaaggggatctgtgaaggtcgacttggcagttcttgacatttcaataaaaggattgatttcccaggatggcaacttttaaaatatttgttcataatgaaaatggtagcaaatttccacataaactttaaagagccttagttcaaatttatttctctgtctcatctacctatctacctatccatccatccatctatccatccatccatccatctacttgagttctttgtatacagccCTAGCTGTGCTGGACCAGGCTGGCCTCAAACTCACAGAGGTCTACCACCTTCTGCCTCCTGAGTACTGGGATTAAAGGCGTGCACCACCACCTGATTAATTTTATTTGTTTCATTATTTACAGACACAGTGGAGGACAGGCTTTTTGAGCTCGGCC
This mutation is a 467 bp deletion beginning at Chromosome 10 position 83,300,925 bp and ending after 83,301,391 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41247 | CCA TCT ATC CAT CCA TCC ATC | Wild type Forward | A | |||
| 41248 | CAG GAG GCA GAA GGT GGT AG | Common | A | |||
| 41249 | AGC CCC TTC AAA GTG AAA GC | Mutant Forward | A | |||
| 41250 | Fluorophore-1 | CAT CTA CTT GAG TTC TTT GTA TAC AGC C | Quencher-1 | WT Probe | ||
| 41251 | Fluorophore-2 | CCC AGC ACC CTA GCT GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41247 | 0.40 uM |
| 41248 | 0.40 uM |
| 41249 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.