Protocol 34201: Probe Assay - Rigi<em1(IMPC)J>Alternate2
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr4:40229653-40229772 120bp TGCCACTGATTTGAACAGGA TGGCTTCACAAAGTCCACAGT

Mut= 100 bp

Wt= 120 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletions in lower case):

ATTCTTCAAAGCACATCTCCAGTGACTCACTTCTCCCAGAGAGGGTACAGTTCTCAGTTGCTCCTTCTGTATGAACTCAATGTGCTGCCAGTGGTGACGCCAGGACTCGAAGGATGTGGTCACCAGGTcccgcagggtgtggtcacctctaaagactgtcaccagctggtgtccaagcctgcaacctgtcagcctcatggtctggctccccagactgtccagtgactgaggccatttgcagatggttttcagttcccttgccactgatttgaacaggattcccatgattttgacttcaaagcatttttatgttggatttgcttaagaaatccccatttctcttttctttttcaggttactgtggactttgtgaagccatcgaaagttgggactttcaaaaaattgaaaagttagaggaacacagattacttttaagacgtttagaaccagaatttaaggccacagttgatccaaatgatatcctttctgaactatccgaatgtttgattaatcaggaatgtgaagaaatcagacaggtaaaccaatgccaggtactaaatttgaagaaaaatgcagagacattggaaatgcccatttttctgtcttgttttaggcccaaggataattgaaacccataaaagctctcaTCTAgcagatataatgactagaatagaatttttaaagtgaatggggtaatttttgtgctagactattagaaaattatttaacctatttgcagttaaagttgcccccttactttaaaaaaaatagtggtttatgcataatgcaaatcacaccaaacagtgcaacaattaaAAGGAAAAATATGTCAGGCTCTTGGGCATAGATACATTTATTACAGTCTCGCAGTCACTTAACTAGTGATGTGATGCCAGGCAGTTCTCTAAGCATCTGTGGGGTTTTTGTTGTTGTTGTTGTTGTTGTTTGTTTGT

This mutation is a 688 bp deletion beginning at Chromosome 4 position 40,229,215 bp for 523 bp followed by a 4 bp endogenous retention (TCTA) then a further 165 bp deletion ending after 40,229,902 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
41168 CAG GAC TCG AAG GAT GTG GT Mutant Forward A
41170 CAC TAG TTA AGT GAC TGC GAG ACT G Mutant Reverse A
43047 TGC CAC TGA TTT GAA CAG GA Wild type Forward A
43048 TGG CTT CAC AAA GTC CAC AGT Wild type Reverse A
43049 Fluorophore-1 CCA TGA TTT TGA CTT CAA AGC A Quencher-1 WT Probe
43050 Fluorophore-2 TGT CAG GCT CTT GGG CAT AGA TAC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
41168 0.40 uM
41170 0.40 uM
43047 0.40 uM
43048 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.