For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:40229653-40229772 120bp TGCCACTGATTTGAACAGGA TGGCTTCACAAAGTCCACAGT
Mut= 100 bp
Wt= 120 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
ATTCTTCAAAGCACATCTCCAGTGACTCACTTCTCCCAGAGAGGGTACAGTTCTCAGTTGCTCCTTCTGTATGAACTCAATGTGCTGCCAGTGGTGACGCCAGGACTCGAAGGATGTGGTCACCAGGTcccgcagggtgtggtcacctctaaagactgtcaccagctggtgtccaagcctgcaacctgtcagcctcatggtctggctccccagactgtccagtgactgaggccatttgcagatggttttcagttcccttgccactgatttgaacaggattcccatgattttgacttcaaagcatttttatgttggatttgcttaagaaatccccatttctcttttctttttcaggttactgtggactttgtgaagccatcgaaagttgggactttcaaaaaattgaaaagttagaggaacacagattacttttaagacgtttagaaccagaatttaaggccacagttgatccaaatgatatcctttctgaactatccgaatgtttgattaatcaggaatgtgaagaaatcagacaggtaaaccaatgccaggtactaaatttgaagaaaaatgcagagacattggaaatgcccatttttctgtcttgttttaggcccaaggataattgaaacccataaaagctctcaTCTAgcagatataatgactagaatagaatttttaaagtgaatggggtaatttttgtgctagactattagaaaattatttaacctatttgcagttaaagttgcccccttactttaaaaaaaatagtggtttatgcataatgcaaatcacaccaaacagtgcaacaattaaAAGGAAAAATATGTCAGGCTCTTGGGCATAGATACATTTATTACAGTCTCGCAGTCACTTAACTAGTGATGTGATGCCAGGCAGTTCTCTAAGCATCTGTGGGGTTTTTGTTGTTGTTGTTGTTGTTGTTTGTTTGT
This mutation is a 688 bp deletion beginning at Chromosome 4 position 40,229,215 bp for 523 bp followed by a 4 bp endogenous retention (TCTA) then a further 165 bp deletion ending after 40,229,902 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41168 | CAG GAC TCG AAG GAT GTG GT | Mutant Forward | A | |||
| 41170 | CAC TAG TTA AGT GAC TGC GAG ACT G | Mutant Reverse | A | |||
| 43047 | TGC CAC TGA TTT GAA CAG GA | Wild type Forward | A | |||
| 43048 | TGG CTT CAC AAA GTC CAC AGT | Wild type Reverse | A | |||
| 43049 | Fluorophore-1 | CCA TGA TTT TGA CTT CAA AGC A | Quencher-1 | WT Probe | ||
| 43050 | Fluorophore-2 | TGT CAG GCT CTT GGG CAT AGA TAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41168 | 0.40 uM |
| 41170 | 0.40 uM |
| 43047 | 0.40 uM |
| 43048 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.