For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032146
Protocol 33068: Probe Assay - Fbxo21<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
305 bp deletion beginning at Chromosome 5 position 117,979,701 bp and ending after 117,980,005 bp (GRCm38/mm10).
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 83 bp
Wild Type = 86 bp
>chr5:117979673+117979758 86bp CTATGTGTCTGCCAGGGTCA GAAGCCATTACAGGGGACCT
Sequence
Sequence (deletion in uppercase) tgtaagagccgctgtcactgctctatgtgtggcctccctcccttgggactctcagctatgtgtctgccagggtcagccacgctAACTCATGGTTGAGGCCTCCTGTGTGTGTCTTCTCCACAGGTCCCCTGTAATGGCTTCAGTGACATTGAAAACCTTGAGGGCCCAGAGATCTTTTTTGAGGATGAGCTGGTGTGTATCCTAAACATGGAAGGAAGGTAAGGCACAGCTTCACCAGGATAACTGCAGAGGGAATTGCTGTGGGGCAGAGAGAGAGAGAGAGTGAGAGAGAGAGAGATTGCGCGAGCGAGCGAGGGAGCTGCGGTGTTTCCAGATAGTTTATGTTATGCCACAGTTATGCTCTGAGAAGCTTTGTGTACACCTACTCccggggtgcacagttgacaggtggctcacccctgaagtcccagtgctcaggaggtcggggcaggagaagcggcagctttgagagagcgctgcatagtgagcttcagaaca
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40603 | CTA TGT GTC TGC CAG GGT CA | Common | A | |||
| 40604 | GAA GCC ATT ACA GGG GAC CT | Wild type Reverse | A | |||
| 40605 | ACC TCC TGA GCA CTG GGA CT | Mutant Reverse | A | |||
| 40606 | Fluorophore-1 | CAT GGT TGA GGC CTC CTG TGT G | Quencher-1 | WT Probe | ||
| 40607 | Fluorophore-2 | CAC AGT TGA CAG GTG GCT CAC CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40603 | 0.40 uM |
| 40604 | 0.40 uM |
| 40605 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.