Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr5:36619599-36619723 125bp GGATCGAGACTTTAGTAGAAGAGC GGCTTGGTGACACACTCTACA
Mut= 120 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletions in lower case; and insertions with carrots ^g^ (CCAAG insertion):
CAGGACAGCCAGGGCTACACAGAGAAATCATGTATTGAAAAACCAAAAAAGAAAAAAGAAAAGAAAAGAAAAAATACTTACAGTAGGTTAGCTTTACCGgtttttaaactctgggattcatttaagaattgataatatattccttttggaacatggaaacttgtggtcctccgtagtgacataaaataattgcctgtctactgtgcctggtagaaagctgactgtcttctctctcacacagagctctgggatcgagactttagtagaagagctctgctgcagactgaaagacctacagagcgagcaaggtgagcaggctggggcaggtagagccctacaggGtccttctcagtgtagagtgtgtcaccaagccAGCATTCCTCATTACCTCAGCTCTGCACAAGGCTTCAGTGAAGTCCTTAGTGGCCACATGGGAAATCCCTGCTCCAGAGGAGGGCTGTAGTCCGTGGGCACCTTCTAAGGCTTCACTTGGGGGTTCAGTCATTTAAGTTCCTAAGTGTTCTGCAGGACTCCAGGAAGGGGCTGCATACTCTGAAACCC^ttttctgtccttgtcaa^GGTCATTGTCAGCGTATACTCTTGAAGCCTTGTGTTAAGGGTCCACCTTATTTT
This mutation is a 242 bp deletion beginning at Chromosome 5 position 36,619,631 bp and ending after 36,619,872 bp (GRCm38/mm10). In addition, there is a (CCAAG) 5 bp insertion and a 17 bp deletion (TTTTCTGTCCTTGTCAA) 220 bp after the 242 bp deletion that will not alter the results of the exon deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
40530 | GGA TCG AGA CTT TAG TAG AAG AGC | Wild type Forward | A | |||
40531 | GGC TTG GTG ACA CAC TCT ACA | Common | A | |||
40532 | GGG CTA CAC AGA GAA ATC ATG T | Mutant Forward | A | |||
40533 | Fluorophore-1 | CTG CTG CAG ACT GAA AGA CCT A | Quencher-1 | WT Probe | ||
40534 | Fluorophore-2 | TTA GCT TTA CCG GTC CTT CTC A | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
40530 | 0.40 uM |
40531 | 0.40 uM |
40532 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |