Protocol 33280: Probe Assay - Tedc2<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:24220325-24220425 101bp TGCTTTTAGACTCCGGTTGC CAGCCATGGTATGGTCCAA

Mut= 81 bp

Wt= 101 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

TGCTGCAGGTCTGGTACGCGGACCCAGGACCTCCTGGCCAGTCCCTCCTCGGACCATCAGGATTATGCAGAGTCCCAGGGCCTAGAAGGCCAAATACAAATGCATGCTTTTAGACTCCGGTTGCCATTGCTATCCTTACCCCttatccagggtctgaggctgggaatctgcttagggatagaatgtttggaccataccatggctgccctgtctttgcagggaaccagccaggaccccatctccagttccagaaaccaaagaagaggacccaagtccaggtaaacgttagctgctttttatgggtgctgtccctggcctttctctggcttgctgtcatgggggaatccatcctgggacagtgaggaggaattcttgcatggttcttgacgttcatagcatgtgcaccgagttctcaagatctcgaggagctggaacttttgacccaggctctggagaaggctgtacgtgtgaggaaaggcgtgtccaatgctggacaaagagacagaacccccactctgacatctaaggcagccacttctggtgccgctgccgcctcccatcctcgggctcccagccggggtggcagccgtgtattgggtacaagatccaccaagggtatacagcgggccacagcccctcccaaggattaccctgagcacagactacgatcaaagggtgataagacccatgtaagaacacaagaccaaactactgggtatggaccagacctcagggaccaacaaatgaccccgtcatctgctcatcacaccacagaactcttcgcattaaaggagaaggggtaagcttcccagacgctcgtatcctgacagggcattgagctggttgaggaagcccctggtgccgacccgtaagggtcatgcactgaagcaaacagggcagaacagggttgggatggtatcaggtttgtcgttctggagcctaaccagcccatgagctctctggactgggcgagcacccaccctcctccagaagccgttttcaaaaagcttgtcagaattaagctgttaaaggagaggaggtgagaaggttcgccccaatgggTTCTGAGCCATGAGTAAGAATGACAGTCCTAATGCCGGGCTTGGTGGCCCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCGGGGCCAGCCTGGTCTACAGAGTGAGTTTCAGGACAGCCAGGGCTACACAGAGAAACCCTGT

This mutation is a 920 bp deletion beginning at Chromosome 17 position 24,219,468 bp and ending after 24,220,387 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
41039 TGC TTT TAG ACT CCG GTT GC Common A
41040 CAG CCA TGG TAT GGT CCA A Wild type Reverse A
41041 CAA GCC CGG CAT TAG GAC T Mutant Reverse A
41042 Fluorophore-1 TGA GGC TGG GAA TCT GCT TA Quencher-1 WT Probe
41043 Fluorophore-2 CCC CTT CTG AGC CAT GAG T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
41039 0.40 uM
41040 0.40 uM
41041 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.