For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032126
Protocol 33277: Probe Assay - Tasor2<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:3596711-3596800 90bp GACGGAGTTACTTGGAGCAGA GCCACAGAGTGGGCAATAAC
Mut= 109 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAACTCCGGACCTTTGGAAGAACAGTCGGGTGTTCTTACCCACTAAGCCGTCTCACCAGCCCCCTTTCTCCAGCCTTTTAAGGACTTTTTTATAATTATATTTTTGTTTGCATTTGCATTAGAACGTGATAAGCTTAtgtcggtatttattacactgttttatgagtttttgttttttaggccccgggaactagattttaagtatgtaatggacgtgtcttctctgaaagaaagtctaccagaagctgcctttagaagacggagttacttggagcagaaaggtctgttgaaatgtaatggcaccctctGTATACTGGGCTTTCTTCAGTTATTGCCCACTCTGTGGCCCATACATTCATTTACATCTTAAATACTTTTTTTTTCTTTTCTTTTTTTTTTTCAAGACCAGGTTTCTCTATGTAGCCCTGGCTGTCCTGGAACTCACTCTGCAGACCAGGCTGGCCTCGAACTCAGAGA
This mutation is a 171 bp deletion beginning at Chromosome 13 position 3,596,750 bp and ending after 3,596,920 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41031 | GAC GGA GTT ACT TGG AGC AGA | Wild type Forward | A | |||
| 41032 | GCC ACA GAG TGG GCA ATA AC | Common | A | |||
| 41033 | CTC CAG CCT TTT AAG GAC TTT T | Mutant Forward | A | |||
| 41034 | Fluorophore-1 | AAG GTC TGT TGA AAT GTA ATG GC | Quencher-1 | WT Probe | ||
| 41035 | Fluorophore-2 | ACG TGA TAA GCT TAG TAT ACT GGG CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41031 | 0.40 uM |
| 41032 | 0.40 uM |
| 41033 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.