Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr18:34644899-34645023 125bp AGCCTGTGCTGACGGAGAGT GTTGCAGAAAGCAAGCATGA
Mut= 117 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (GTCTATA insertion):
GTGTTTCACCACGCCCGGCTTTCATATTTTTACATATCTGTAGTTCATTACTATATTTAAGTGTTTGGTGCTTAATTTATTCCATATTTATTCAGTGGGAACACCTGAATGAATGGTTGTCTATAAGGCGGATGTTGTT^ttgcttaggcattagttagccctgtagatagaaccagctgctggttttattaataagccagacaacaacaaaaatcatcaacaaaaacccaaaccctattcgttgatttctgtcttcccccttacagtctggagagaagaagaaggatgacgaaacagttgatagcctaggtatgaccccccaccccccatgcaggaaccctaagaccgcacagcctgtgctgacggagagtggcttccctcagccactgctgtcatccatctctacccg^AGGGCTGCTGTGGGAATCAGCCTGTGGGTATGCTTGCCCCGCTTGAATCATGCTTGCTTTCTGCAACCTAAGGTGGAAAATTGTTTTAACTGAAACTTCTGAGTTGTAAACATTGATAAGTCGGACTACACCAGCCAT
This mutation is a 270 bp deletion beginning at Chromosome 18 position 34,644,966 bp and ending after 34,645,235 bp (GRCm38/mm10). In addition, there is a 7 bp insertion (GTCTATA) at the deletion site that will not alter the results of the exon deletion
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
40359 | AGC CTG TGC TGA CGG AGA GT | Wild type Forward | A | |||
40360 | GTT GCA GAA AGC AAG CAT GA | Common | A | |||
40361 | GGG AAC ACC TGA ATG AAT GG | Mutant Forward | A | |||
40362 | Fluorophore-1 | TGC TGT CAT CCA TCT CTA CCC | Quencher-1 | WT Probe | ||
40363 | Fluorophore-2 | TGT TGT TGT CTA TAA GGG CTG CT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
40359 | 0.40 uM |
40360 | 0.40 uM |
40361 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |