For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:87185123+87185226 104bp CCCAGGGTAGGAGAACATCA GCCTGTAAGTGTGGCTGTTG
Mut= 120 bp
Wt= 104 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATCCAGCACAGACTACATGAATGCCAAGGTTGTACCAGAAGTGCTACCCCACCCAGCAGACTCACATTGGTACAGGGGACTCCTCCTTTTGTCCATGTCCAGCCCTTATTTTTAGGTTCCATCgtccttggggtcagattctttttgaaggtccaagtggaaggggtatgccaaacttgagacacagcagggaggaggggagagtgtgggctcaggtggtcacagttcatggctgctcaaatagttccatgtgctagaaggcgggccaagtggagagtggttgaaagatgaggcccagcccccccccccaataaagcgaaagatccgcaagagggcgcagcgaggctcaaaggattgtttctcagtaggacctggacgccctagacctcaagcccccctcctccaggacccaccggagccaggtgaaactaaaagactccaagggctgaaagcgaggtgggcctcaacgtgaagataactaaaacttttgcttcatgacgccgtttctgccattctagtacaatgtggagaaagacatcaaggcgttgccaacacgacccgggctcacggccgcatagtcggtggcagcacggctccctcgggggcctggccttggctagtgaggctgcaacttggagggttgcctctgtgcgggggtgtcctggtagcagcatcctgggtgctcacggctgcacattgcttcgccgggtacgtcgtcgagattccaggcacctgctcagcagggccacccaatccgatgggagtctaagcacccatgggccaaagcagagcagagcaggtctctgctgccccctagcggaagctagctcccaacctcgggccttaaaatgccggttgcgggtgggggtgggggtgggggtgagggatcccagggtaggagaacatcacactgaattttcccactgcagggaatctgcaccttcccggtctccctctctttcccttggGTCACAACAGCCACACTTACAGGCTCACTGGATGGTGTGGGTGCATGAGGGTCTGGGCCTCTGAGGGGGCCTCACGCCACCCTCTGTCCCTGATTGGTGTCACCCA
This mutation is a 845 bp deletion beginning at Chromosome 1 position 87,184,358 bp and ending after 87,185,202 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40354 | CCC AGG GTA GGA GAA CAT CA | Wild type Forward | A | |||
| 40355 | GCC TGT AAG TGT GGC TGT TG | Common | A | |||
| 40356 | GGT TGT ACC AGA AGT GCT ACC C | Mutant Forward | A | |||
| 40357 | Fluorophore-1 | TTC CCA CTG CAG GGA ATC T | Quencher-1 | WT Probe | ||
| 40358 | Fluorophore-2 | CCT TAT TTT TAG GTT CCA TCG TCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40354 | 0.40 uM |
| 40355 | 0.40 uM |
| 40356 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.