For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032040
Protocol 32791: Probe Assay - Eps15l1<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:72384915-72385021 107bp GGGCTGTATGGTCCTGACAC CCACTGGTGGCTGAAACAG
Mut= 111 bp
Wt= 107 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATCCTGAGACTATCTCCATATGCTATTGTTCTGGGTTTACAGGAAGCAGAAATGGTAGCAGCAGAGATCCCCCACTGACCCGAACTTCACTGTATGTGTGTATGTTTATCTGACCTTTTTTTATTCTCTCTGCTCCTAGCCAGGGTCCTGGACTGGGCTGTATGGTCCTGACACTGTCAGTGAGAAGTATAAGCAGAGctgagactgggacagggctcacaaataagtcactctgttgtaacctgtttcagccaccagtggcctgggttgtgcctgtggcagataagatgcgctttgatgagatctttttgaagacagacctggaccttgatggctatgtgagtggccaggaagttaaggagatcttcatgcactcaggcctcactcagaaccttctggcacacatctggtaatgatggaaacattggtggaggtgctctgagaggctgggaaagagggtggggagggctcccgttttccaggtgacagtatacagggagGTAGGGTCAGCCCTTATCTGATACTGGAGAGCTGTGTTGAAAATAGTCTTCTCCACAAGCCTTACCTTGTCACAGCCACCTGTAACGGTTACTCTGCCTGCCACTTGAGTAACCTCAACAAGGACCTTGACAGTTCCAGTGAGGTCCCACTTGGACATGGGCATTCCAAGTACATTGCACTGAAGTCGAGTGGGTCACCAGAGTGTGATTTTGTGGGGGGCAA
This mutation is a 302 bp deletion beginning at Chromosome 8 position 72,384,676 bp and ending after 72,384,977 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39994 | GGG CTG TAT GGT CCT GAC AC | Common | A | |||
| 39995 | CCA CTG GTG GCT GAA ACA G | Wild type Reverse | A | |||
| 39996 | AGG TAA GGC TTG TGG AGA AGA | Mutant Reverse | A | |||
| 39997 | Fluorophore-1 | CAG GGC TCA CAA ATA AGT CAC TC | Quencher-1 | WT Probe | ||
| 39998 | Fluorophore-2 | AAG CAG AGG TAG GGT CAG CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39994 | 0.40 uM |
| 39995 | 0.40 uM |
| 39996 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.