Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr17:71280572-71280660 89bp CATTGGTACCCTGCTGTGTG AGCATCTGCTCAGTCGTCCA
Mut= 90 bp
Wt= 89 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletion in lower case; and insertions with carrots ^g^ (CTTAGA insertion):
CTGACTCCTCCAGCTAGGCTCCACTTAAGGCCTTTAGAAGCTCCCCCCCCCCCATAGTGCTACCATTTAGGGACAAAGTATTTATAGCAGAGCCTATGCAGGACATTTCACATCACAACAAGGGTCAGCATGGGAGGACTGG^agactctcttaaaactagtggtcactaaagtgagaccctgttttctctgtctttaggtatcgggtaaactttagacccagatttgtcactagatacaagatagtgacacagttggaatggagatgctgtcctggctttagaggaccagactgccaagaaggtcccaaagaccacatgaagaccccccggcccccatcagctcgaccaaaaaacaacctgaagaaagccacaggtaatgaatgtctcattggtaccctgctgtgtgtggtcacatttgatgtccctggtgttgttaccaag^GACAGGGTTGATAATGGACGACTGAGCAGATGCTCATGTAGAGGGATTGTTATCTGAAGGGGCAGGAGTGGTTGGGTCGCACATATTTCCTTGCAAGTAAATTTCCTCGTTAGGGCCACTTGTAGATTAGCCAGGAGTGGTGGTACACATCTGGGAGGT
This mutation a 300 bp deletion beginning at Chromosome 17 position 71,280,606 bp and ending after 71,280,905 bp (GRCm38/mm10). In addition, there is a 6 bp insertion (TCTAAG) at the deletion site, that will not alter the results of the exon deletion.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
39942 | CAT TGG TAC CCT GCT GTG TG | Wild type Forward | A | |||
39943 | AGC ATC TGC TCA GTC GTC CA | Common | A | |||
39944 | CCT ATG CAG GAC ATT TCA CAT C | Mutant Forward | A | |||
39945 | Fluorophore-1 | CAC ATT TGA TGT CCC TGG TG | Quencher-1 | WT Probe | ||
40859 | Fluorophore-2 | ACT GGC TTA GAG ACA GGG TTG A | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
39942 | 0.40 uM |
39943 | 0.40 uM |
39944 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |