Protocol 32777: Probe Assay - Krt25<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:99321872-99322023 152bp CGTGCGGTCCTAATTCAGAG CTCTTCCTCCTCCCATCCTC

Mut= 153 bp

Wt= 152 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

AATCATGAAGTAGATTCAAGTATTTAACTTCATGTTAAACATGCCCTTGGCTGATAACTTAGTTGATTTTTATCATTAGCATTTTCTAACATTAAAAAAAAAACTTTACCAAAATAAATAAATAAATAAATACCACCTTTACcttttaaaattattgtgataaataatagcctttttaaaaagtcaaacccctggtttccagatcatcacctccaccaccagcaacgccaacgctgtactgcagattgacaatgccaggctcacggctgatgacttcagactcaagtaagtcagtgagcgaaaagaatccatggggattcgtgcggtcctaattcagagttgttcttaatccctccatcaaattctagtcagtcttactccaacgttagaaagcgcttggatttaaagtaagcaagatgaacctacaggggagaaaagactgttccagccagaggatgggaggaggaagaggaagtgctctagagaggccagccttagcCGAGGCATTCAAGGGGTACCTGAATAAAGTCAAGCCAATAAGATCCATCAAGATCCCAGCGGGCAGCACTGATTGGGCGCTAAGTTACAAAAAAACAAAAAAACAAAAAAAACAAAAA

This mutation is a 357 bp deletion beginning at Chromosome 11 position 99,321,844 bp and ending after 99,322,200 bp (GRCm38/mm10). In addition, there is a 10 bp deletion (ATCCCTTAAA) 160 bp after the 357 bp deletion, that will not alter the results of the exon deletion.  

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39959 CGT GCG GTC CTA ATT CAG AG Wild type Forward A
39960 CTC TTC CTC CTC CCA TCC TC Wild type Reverse A
39961 TGC CCT TGG CTG ATA ACT TAG Mutant Forward A
39962 CTT GAT GGA TCT TAT TGG CTT G Mutant Reverse A
39963 Fluorophore-1 ATC CCT CCA TCA AAT TCT AGT CAG Quencher-1 WT Probe
39964 Fluorophore-2 CCA CCT TTA CCG AGG CAT T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39959 0.40 uM
39960 0.40 uM
39961 0.40 uM
39962 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.