Protocol 32740: Probe Assay - Naa16<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr14:79386924-79387018 95bp CTGTCCCATCTGTTGCACTG TTCATGCCGAGAATGTGAGT

Mut= 95 bp

Wt= 95 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletion in lower case):

 

CAGTGGTAACTAAGTCACAGTCATATGGCTTTAAAAGTCTTTATTCTGTGTCAGTGTTGGTTGATGATTATGCATTTATTGAGTTTATTCTTCATTTATGTCTCTATCTCTTACAatagtggagatgctacatgtcaaggcatatataaccgcacttaatgctgaaattaatatagacagaagagcatgtcatcacattttaaactttggatcttgaattgataagatataataaaacttggttcattattttataaaataacctgctgtttccttttagaaatgttatgaacagaagcagtacaaaaatggcctcaagttttgcaagatgattctttctaacccgaagtttgctgaacatggaggtactgtcccatctgttgcactgtgctttgggggaacacaattctaaagccaggcaggacttctgaaagtgcaggaggactcacattctcggcatgaatgtttagcatttcttggttatgtttcgagtgaatcttaggttgagctagtttcatgctctagtatgtgcagtgccttgacttttaatgaggaagtcggtgagagacaattggatgaggtagtgtgcatgttaacatccctctcaGAAGTGCTTCAGATACCCGATGAGCTCAGACTTTGGAATAATTGTTTAGATTACCAGTTATACACACCAATTCAAAAAATCTTGAAACTCTAGTTTCAACTCTTAG

This mutation is a 492 bp deletion beginning at Chromosome 14 position 79,386,780 bp and ending after 79,387,271 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39856 CTG TCC CAT CTG TTG CAC TG Wild type Forward A
39857 TTC ATG CCG AGA ATG TGA GT Wild type Reverse A
39858 CTG TGT CAG TGT TGG TTG ATG A Mutant Forward A
39859 GCT CAT CGG GTA TCT GAA GC Mutant Reverse A
39860 Fluorophore-1 CAG GAC TTC TGA AAG TGC AGG Quencher-1 WT Probe
39861 Fluorophore-2 TTC ATT TAT GTC TCT ATC TCT TAC AGA AGT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39856 0.40 uM
39857 0.40 uM
39858 0.40 uM
39859 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.