Protocol 32602: Probe Assay - Ankrd28<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr14:31764235-31764327 93bp TGAGAAGAGAACCCCTTTGC AGCTCAGGAGTTGCCATACC

Mut= 107 bp

Wt= 93 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence (deletions in lower case):

 

TAACTGTACATAATATCTTTAAGAATTTTACATGTGAACAAAATTTCTTCAAAGTTAGTTTTTTATTTATGGTTACACATCACTTCTCGAAACCTTTTGGGATTTGTTTCATTTCAGATATTTTAaaaataggactgggtggtttggctcaagcCATGGTTTTATAGCCAAGTAAATTTGTAAAGGCTTTTACTTGTCTTAGCTGTAAAACACCCAAGattttgttggcgagacttgcagagtagagttgtggaaatattaatttgttagttaataatgttggatttcattcatactacattattttttattaaagtgcagtttcctcttttcacaggacaatgagaagagaacccctttgcatgctgctgcctatcttggtgacgcagaaatcattgagctgcttattttatctggtatggcaactcctgagctgagttcatggtgttcagtttgatgtatgagtgttcctatggaatgcatagcctatgtcttagtattggtttcataagttaaccaattataatagcaaactttgatcatagaacctgttttgggtgcttaaagtactttaagaaatagaacaaagatttctgtccttacAGACTTATTAGTTCCATAAATACAAGTCATTTTATAGTTTGTTTAAAAGATAATAATTGCTACTGTGGAAAAATGAAAAACATAGATTGGGAAGAATAGGAAAGAGACATATGTCAGGAAAGG

 

This mutation is a 385 bp deletion beginning at Chromosome 14 position 31,764,067 bp and ending after 31,764,451 bp (GRCm38/mm10). In addition there is a 29 bp intronic deletion, Chr 14 :31,764,516 -31,764,544, which is 64 bp before the 385 bp deletion, that will not alter the results of the exon deletion. 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39518 TGA GAA GAG AAC CCC TTT GC Wild type Forward A
39519 AGC TCA GGA GTT GCC ATA CC Wild type Reverse A
39520 CGA AAC CTT TTG GGA TTT GT Mutant Forward A
39521 AGT CTC TTG GGT GTT TTA CAG C Mutant Reverse A
39522 Fluorophore-1 TGC TGC TGC CTA TCT TGG T Quencher-1 WT Probe
39523 Fluorophore-2 CAG ATA TTT TAC ATG GTT TTA TAG CCA AG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39518 0.40 uM
39519 0.40 uM
39520 0.40 uM
39521 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.