For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:55795118-55795263 146bp CTCCAATTCTCAGACCTAGAACCT CAACCACTGGCTATTGTTTTCT
Mut= 125 bp
Wt= 146 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
AGTGTAAATTAAGTTTTCTTTTTATCCTGGGGATTGAATCCAAGGCCTAGTACATGCTAAGTGTGGGTTTTCTCATTAAGCTACTCCAATTCTCAGACCTAGAACCTGAATTTAGAATAATTATGCTAAGGAGTAGtgagAAGGTTTATAGTATTgtctatataataaatagaccatgatttagcatttgtctaaaagaatcattgaagaaaacaatagccagtggttgaaatatttaagttcattaagtagttgttaatagtgagtgtatttaaagtatttttctgttccaaatatttcaggtcacaagtctcaaagagaggaattagatgctatactttttatttttgaggtaagtgctatgaatcatactgtttaaactttttcaaaaaattattctgagaatataaagaaatatattaaaattattagacatatagtgaaacatagttaacctgccagccttttGAAGAACTTAATTAACTTTAAAAATGTATCTGGCTGAACTTGTGTATTTTTGAAGTATAATGTATTTTTTAGCAACAAAATTATGCATCTGACAATATAAAATTCATTTGATAGCATTTTTATAAAGTGAAAAAAAATTTTTTAA
This mutation is a 313 bp deletion beginning at Chromosome 12 position 55,794,879 bp and ending after 55,795,191 bp (GRCm38/mm10). In addition there is a 4 bp deletion (TGAG) 15 bp before the 313 bp deletion that will not alter the results of the mutation.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39256 | CTC CAA TTC TCA GAC CTA GAA CCT | Common | A | |||
| 39257 | CAA CCA CTG GCT ATT GTT TTC T | Wild type Reverse | A | |||
| 39258 | TCA AAA ATA CAC AAG TTC AGC CAG A | Mutant Reverse | A | |||
| 39259 | Fluorophore-1 | AGA CCA TGA TTT AGC ATT TGT CTA AAA | Quencher-1 | WT Probe | ||
| 41194 | Fluorophore-2 | AGG AGT AGA AGG TTT ATA GTA TTG AAG AAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39256 | 0.40 uM |
| 39257 | 0.40 uM |
| 39258 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.