For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:59727279+59727362 84bp TAGGATCTTGGCTGCCTGCT AACAGTGTCCTGGCTTGCAC
Mut= 86 bp
Wt= 84 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGCCTTTGGGTCTGTCTCCCAATCTTAGAGCTAGTGCTCAAAGATGTGGCTCTATTTACCTACCTCCTTACGTGTTTTTTTGTTTGTTTGTTTGTTTTTTTTTTTTCTATTTTGAATCTACTATTCCCGAAGCTTTTCCTCACTGATCTGAGACTAGGATCTTGGCTGCCTGCTCTCCCTagcattcctcactgagcactgtcctgacccctcctgcggtgcaagccaggacactgttctccatgtagaaaataaagtccagagggtgtgtcctctacataagtccagcttggcttgccccaccgtggatgggtgggtaggaagtggtgctgtgaaggctgaggactgaaggcaaggggtgggtcctgctggtggctgtgggacctgacacaccaccccttttgagtgacttgttttgtccttgcagcccaccaccctccctcagggcaccatcaacatgaaccagtgcacagatgtggtggatggggaggcccgcacagggcagaagttctccctctgcatcctgacacctgacaaggaacattttatcagggcagaaaccaaggagatcatcagtgggtaagttggccagagccacaggaggcactgtctgtttgctcacccatttctggggactccagggcttctaggtcttccttggaactcttcactgattggtcgtcctcccaccccacacctcatcctcaccctgtgcctccttggcactcagcacacagtgctgctcctgccttcccctcaagtaaaataagccctcttttctaggctgtgtatcaggcagcctgcgtggcggcccctttgagaaacgtcccgtgtaGCACCAAAGCCTCCAGGTGATTCACATGCATGTATTTTCGGTCCTCAGTGATTAACCCCATTCATTCTCTACGGCTGGAAGAGGGCAGGTGTGTCATCAAGGCTCTGTCTGAGGTTGAGGGGTATAGGCTGTGTATAGCACAGGGTAGAGGGAAGTAAGGACATGAA
This mutation is a 655 bp deletion beginning at Chromosome 11 position 59,727,305 bp and ending after 59,727,959 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39075 | TAG GAT CTT GGC TGC CTG CT | Common | A | |||
| 39076 | AAC AGT GTC CTG GCT TGC AC | Wild type Reverse | A | |||
| 39077 | TGG GGT TAA TCA CTG AGG AC | Mutant Reverse | A | |||
| 39078 | Fluorophore-1 | ATT CCT CAC TGA GCA CTG TCC T | Quencher-1 | WT Probe | ||
| 39079 | Fluorophore-2 | CCT GCA CCA AAG CCT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39075 | 0.40 uM |
| 39076 | 0.40 uM |
| 39077 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.