Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 127 bp
Wild Type = 142 bp
>chr6:126739793-126739934 142bp CCGAGGTGACATGAGATCG CACCAACCTCTCACTACTACAGCA
Wt Sequence (deleted region in lower case):
CCGCCAGGTCAGAGCACGGGCCCCACCCTAAAGGAGGGCACAGCCGAAGCTGTGAAGCGGGTGCCGCTCTCTGGAGCTCGTGTCGTGGGCGCCGTCCTAGTGGCGGGGAGCGCACCGCCGAGGTGACATGAGATCGGAGAAATCCCTGAcgctggcggcgccgggggaggtccgtgggccggagggggagcaacaggatgcgggtgagttccaggaggccgagggcggcggcggctgctgtagtagtgagaggttggtgatcaacatctccgggctgcgcttcgagacgcagctgcgcaccctgtcgctgttccctgacacgctgctaggagaccctggccgcagagtccgtttctttgaccccttgaggaacgagtacttctttgaccgcaaccgacccagcttcgacgctatcctttattactatcaatctggaggtcgcctgcgcaggcctgttaatgtgcccctggacatttttatggaagagatccgcttctatcagttgggagaggaagccctggcggccttccgggaggatgagggttgcctgcccgaaggtggcgaggatgagaaaccactcccctcccagcctttccagcgacaggtctggcttctctttgagtacccggagagttccgggcccgcccgaggcatcgccatcgtctcagtattggtcatcctcatctccatcgtcatcttttgcctggagaccttgcctcaattccgtgcagatgggcgcggtggaagcaacgagggtagtgggacccgcttgtctccggcctccaggagccacgaggaagaagatgaggatgaagattcctatgcatttcctggtagcattccctctggggggttggggactggaggaacatcttcacttagtactctcgggggttctttcttcacagaccccttcttcttggtggaaactctgtgtatcgtctggttcacgtttgagctcctggtgcgcttctctgcctgtcccagcaaggcggccttctttcgcaatatcatgaacatcattgacttggtggccattttcccctactttatcaccttgggcaccgagctagtgcaacgtcacgagcagcagtctgtgagtggtggcagtggtcagaatgggcagcaggccatgtccctagccatcctcagggtgatccgcctggtccgggtgttccgaatcttcaagctctcccgccattccaaggggctgcagatcctgggtaagaccttacaggcgtccatgcgggagctcgggctgctcatcttcttcctcttcatcggagtcatcctcttttccagcgctgtctacttcgcagaggctgatgatgttgactcgctcttccctagcatcccagatgccttctggtgggctgtggttacaatgaccacggtaggttatggggacatgtaccccatgacggtagggggcaagattgtgggctcactgtgcgccattgctggggtcctcaccattgcattaccggtaccggtcattgtctccaatttcaactacttctaccaccgagagacggagcaggaggagcaaggccagtatacccacgtcacttgtgggcagcccactccggacttgaaggcaacggacaatgggcttggcaaacctgactttgccgaggcttcacgggaacgccggcccagctaccttccgactccacatcgagcttatgcggagaaaaggatgctcaccgaggttTGATGGATGCGGGCAGGCCTGCAGGAAAACAGGAGCTCTGAGCAAGTCATCTCTCAGGCTTCCTTCTCATGCTCACTACTTCCGCCTTAGCTCCAGAGGACCTCGAACCCCCCTCCCCCCTAACACAGTACATGGCATCTTGGACCAAATATCTGGACTGTAGACTGTTGCTCGATCCTCGCAGCATTCGAGGTTTCTCCATCTTAG
internal deletion beginning at Chromosome 6 negative strand position 126,739,902 bp and ending after 126,738,338 bp (GRCm38/mm10). This mutation deletes 1565 bp of ENSMUSE00000690877 (exon 1)
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
37246 | CCG AGG TGA CAT GAG ATC G | Common | A | |||
37248 | CAC CAA CCT CTC ACT ACT ACA GCA | Wild type Reverse | A | |||
37249 | Fluorophore-1 | TGC AGG AAA ACA GGA GCT CT | Quencher-1 | MUT Probe | ||
37250 | Fluorophore-2 | AAC AGG ATG CGG GTG AGT T | Quencher-2 | WT Probe | ||
37946 | TGG AGC TAA GGC GGA AGT AG | Mutant Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
37246 | 0.40 uM |
37248 | 0.40 uM |
37946 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |