For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 94 bp
Wild Type = 102 bp
>chr5:115330651+115330752 102bp TGTTTCAGGTATGTTCTCACCA CTCCTGAGAAGCCAGCATGT
Wt Sequence:
Mutant Sequence:
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36964 | TGT GTC TGG TGT CCA TCT CC | Mutant Forward | A | |||
36965 | CTC CTG AGA AGC CAG CAT GT | Common | A | |||
36966 | TGT TTC AGG TAT GTT CTC ACC A | Wild type Forward | A | |||
36967 | Fluorophore-1 | CCC TCT GGC TGA CTT CCC | Quencher-1 | MUT Probe | ||
36968 | Fluorophore-2 | ACG AGA GTC TAG CCT TCA AGG A | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36964 | 0.40 uM |
36965 | 0.40 uM |
36966 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |